Prevalence, Detection of Resistance Genes and Antimicrobial Resistance of Campylobacter jejuni in Broilers in North Macedonia

Ljupco Angelovski*, Zagorka Popova, Katerina Blagoevska, Sandra Mojsova, Marija Ratkova Manovska, Mirko Prodanov, Dean Jankuloski, Pavle Sekulovski

Faculty of Veterinary Medicine, Skopje, Ss. Cyril and Methodius University in Skopje, Lazar Pop Trajkov 5-7, 1000 Skopje, R. North Macedonia.

Editor | Muhammad Abubakar, National Veterinary Laboratories, Park Road, Islamabad, Pakistan.

Received | May 11, 2021; Accepted | July 02, 2021; Published | August 23, 2021

*Correspondence | Ljupco Angelovski, Faculty of Veterinary Medicine, Skopje, Ss. Cyril and Methodius University in Skopje, Lazar Pop Trajkov 5-7, 1000 Skopje, R. North Macedonia; Email: angelovski@fvm.ukim.edu.mk

Citation | Angelovski, L., Z. Popova, K. Blagoevska, S. Mojsova, M.R. Manovska, M. Prodanov, D. Jankuloski, P. Sekulovski. 2021. Prevalence, detection of resistance genes and antimicrobial resistance of Campylobacter jejuni in broilers in North Macedonia. Veterinary Sciences: Research and Reviews, 7(2): 101-108.

DOI | https://dx.doi.org/10.17582/journal.vsrr/2021.7.2.101.108

Keywords | Prevalence, Campylobacter jejuni, Resistance genes, Broilers, Antimicrobial resistance

Introduction

The natural habitat for Campylobacter spp. is the intestinal tract, specifically the mucosal cells of mammals and birds. Confirmed sources for infections in humans are poultry meat (cross contamination, undercooked meat), contaminated water, contact with animals and raw milk. The highest frequency of isolation in poultry meat is detected for C. jejuni, followed by C. coli, and C. lari (Hansson et al., 2018). Campylobacteriosis in humans is usually characterized by mild symptoms and in rare cases neurological problems can occur (Silva et al., 2011). Antimicrobial therapy for the infection is usually not needed because of the self-limiting character but in prolonged cases that may be necessary. Drugs of choice in this case are fluoroquinolones (ciprofloxacin) and macrolides (erythromycin) (Blaser and Engberg, 2008; Zhang et al., 2020). Tetracycline have been suggested as an alternative choice in the treatment of clinical Campylobacteriosis, but in practice they are not often used.

Regarding the classes of antibiotics there are several mechanisms of resistance noticed in Campylobacters for each of them. Campylobacter quinolones resistance is mediated by the CmeABC efflux pump and also through a single point mutation in the gyrA gene determining area of quinolone resistance (Iovine, 2013; Shen et al., 2018; Whitehouse et al., 2018). Campylobacter resistances to tetracycline have been mediated by the protein of ribosomal protection TetO that is encoded by the tet(O) gene. The tetO gene is common in C. coli and C. jejuni. C. jejuni aminoglycoside resistance is achieved through aminoglycoside changing enzymes (Sat, aacA AadE, AphD and AphA) that are encoded by plasmid genes. Campylobacter has four main mechanisms for macrolides resistances including: efflux by CmeABC efflux pump, methylation of the ribosome encoded by ermB gene, ribosomal proteins target mutations and mutation in the 23S rRNA gene (Bolinger and Kathariou, 2017). β-lactams resistance in Campylobacter spp. is usually mediated by β-lactamases enzymes, which break down the β-lactam ring structure (Iovine, 2013).

Aims of this study were: to detect the prevalence of C. jejuni in the broiler production chain in North Macedonia, to analyze the antimicrobial resistance towards three important antimicrobials (ciprofloxacin, erythromycin and tetracycline) and to check for presence of resistance genes in the confirmed isolates of C. jejuni.

Materials and Methods

Collection of samples

This study was conducted in North Macedonia during 2017. A total of 283 samples were collected from one farm and one slaughterhouse in the Skopje region of North Macedonia

One week before slaughter cloacal swabs were taken at farm level (n= 64). Cloacal swab samples were collected using sterile cotton swabs and placed in tubes containing 5 ml of Preston broth.

Caeca were collected (n= 166) at the slaughter line during the evisceration phase broiler and packed in sterile bags.

Swab samples from broiler carcasses (n=53) were taken from the storage area before shipping to the consumers (cold chamber of the slaughterhouse) using sterile cotton swabs and placed in tubes containing 5 ml of Preston broth.

After the collection, the samples were transferred to the laboratory at an appropriate temperature (4-8°C) and were analyzed 3-4 hours after sampling.

Isolation and confirmation of Campylobacter spp.

The isolation and identification of thermotolerant Campylobacter was done according to the ISO 10272-1 (ISO, 2017). The positive isolates were sub-cultured on mCCDA agar plates and stored in glycerol broth at -80°C.

Extraction of DNA and PCR analysis

The confirmed Campylobacter isolates were used for extracting the DNA with the conventional boiling method. The procedure included suspension of the cultures in 0.5 ml of TE buffer, boiling at 95°C for 10 min and centrifugation at 15000 rpm for 5 minutes. The supernatants were kept at -20°C and used for both PCR methods.

The multiplex PCR for identification of Campylobacter spp. was done according to the previously published study by Wang et al. (2002). The list of the used primers is shown in Table 1.

The multiplex PCR for detection of the resistance genes in the C. jejuni isolates was performed as proposed in the published study by Obeng et al. (2012). The list of the used primers is shown in Table 2.

For the antimicrobial testing of the isolates disk diffusion method (Kirby Bauer method) was used (EUCAST, 2020). The inoculums were prepared with density adjusted to 0.5 McFarland turbidity standard. The inoculum was delivered with sterile swabs on Columbia blood agar and the following antimicrobial agents were used: erythromycin, ciprofloxacin and tetracycline. The EUCAST breakpoints (EUCAST, 2020) were used for the classification of the isolates (Table 3).

 

Table 1: Primer sequences used in the multiplex PCR assay and the expected sizes of the products (18).

Target gene	Primer name	Sequence (5’–3’)	Annealing temperature (°C)	Product (bp)
C. jejuni hipO	CJF	ACTTCTTTATTGCTTGCTGC	59	323
	CJR	GCCACAACAAGTAAAGAAGC
C. coli glyA	CCF	GTAAAACCAAAGCTTATCGTG	59	126
	CCR	TCCAGCAATGTGTGCAATG
C. lari glyA	CLF	TAGAGAGATAGCAAAAGAGA	59	251
	CLR	TACACATAATAATCCCACCC
C. upsaliensis glyA	CUF	AATTGAAACTCTTGCTATCC	59	204
	CUR	TCATACATTTTACCCGAGCT
C. fetus sapB2	CFF	GCAAATATAAATGTAAGCGGAGAG	59	435
	CFR	TGCAGCGGCCCCACCTAT
C. jejuni 23S rRNA	23SF	TATACCGGTAAGGAGTGCTGGAG	59	650
	23SR	ATCAATTAACCTTCGAGCACCG

*PCR amplifications were performed in a mixture (25 µL) consisting of 12.5 µL of 2×Platinum Multiplex PCR Master Mix (Applied Biosystems, UK), 2.5 µL of template DNA, and 5 µL of primer mix (0.5 µM C. jejuni and C. lari primers; 1 µM C. coli and C. fetus primers, 2 µM C. upsaliensis primers; 0.25 µM 23S rRNA primer). Distilled water was added to make 25 µL.

 

Table 2: Primer sequences used in the multiplex PCR assay and the expected sizes of the products.

Target gene	Primer name	Sequence (5’–3’)	Annealing temperature	Product bp
tet(O)	tet(O)-F	GCGTTTTGTTTATGTGCG	54	559
	tet(O)-R	ATGGACAACCCGACAGAAG
cmeB	cmeB-F	TCCTAGCAGCACAATATG	54	241
	cmeB-R	AGCTTCGATAGCTGCATC
blaOXA-61	BlaOXA-61-F	AGAGTATAATACAAGCG	54	372
	BlaOXA-61-R	TAGTGAGTTGTCAAGCC
aph-3-1	aphA-3-1-F	TGCGTAAAAGATACGGAAG	54	701
	aphA-3-1-R	CAATCAGGCTTGATCCCC
aadE	aadE1-F	GAACAGGATGAACGTATTCG	54	837
	aadE1-R	GCATATGTGCTATCCAGG

*Each multiplex PCR tube contained 25 µL of mixture: 12.5 µL Platinum Multiplex PCR Master Mix (Applied Biosystems, UK), 2.5 µL of template DNA, 5 µL of primer mix (0.5 µM of the used primers), and 5 µL of distilled water.

 

Results and Discussion

Prevalence of C. jejuni at broiler farm and at the slaughterhouse

The results of the study indicated that C. jejuni was present in all phases of the production. The distribution of this microorganism was highest in the cloacal swabs (48.4%). The results from this study confirm that C. jejuni had the highest prevalence in the broiler farms (Table 4), which is in line with previous studies (Schets et al., 2017; Sibanda et al., 2018). The level of prevalence of C. jejuni on the broiler farm was very similar with the level confirmed in two studies in Malaysia and Vietnam (Saleha, 2002; Schwan, 2010).

 

Table 3: Zone of inhibition and concentration of the used antibiotic discs.

Antimicrobial agent	Disc content	Zone of inhibition (mm)
		resistant	susceptible
Ciprofloxacin	5 µg	≤26	26≥
Erythromycin	15 µg	≤20	20≥
Tetracycline	30 µg	≤30	30≥

* Disk diffusion (EUCAST standardised disk diffusion method). Medium: Mueller-Hinton agar + 5% defibrinated horse blood and 20 mg/L β-NAD (MH-F). Inoculum: McFarland 0.5; Incubation: Microaerobic environment, 41±1ºC, 24h; Quality control: C. jejuni ATCC 33560.

 

This study also revealed high prevalence of C. jejuni (40.9%) in the slaughterhouse (evisceration phase) in the cecum samples. This phase (with cecum samples) shows a great variation in the prevalence. In some studies, the prevalence was in accordance with our results (Di Giannatale et al., 2010), but the literature also revealed studies that confirmed even higher prevalence (Perez-Arnedo and Gonzalez-Fandos, 2019).

 

Table 4: Prevalence of C. jejuni at the farm, at the slaughter line and at storage.

Sampling point	No. of samples	Type of sample	C. jejuni
Farm	64	Cloacal swab	31 (48.4%)
Slaughter line	166	Cecum	68 (40.9%)
Storage	53	Carcass swab	12 (22.6%)
Total	283	/	111(39.2%)

*The isolation and identification of thermotolerant Campylobacter was done according to the ISO 10272-1 Microbiology of the food chain, Horizontal method for detection and enumeration of Campylobacter spp., Part 1: Detection method.

 

Table 5: Prevalence of resistance genes in C. jejuni isolates n positive (%).

Species	No.	CmeB	BlaOXA-61	tet(O)	aph-3-1	aadE
C. jejuni	108	21(19.4)	27(25.0)	21(19.4)	0 (0)	15 (13.9)

 

Table 6: Antimicrobial resistance of Campylobacter jejuni.

Antimicrobial agent	resistant (R)	susceptible (S)
	n positive (%)
Ciprofloxacin	68 (63)	40 (37)
Erythromycin	6 (5.6)	94 (94.4)
Tetracycline	54 (50)	54 (50)

*Samples were tested according to the EUCAST guidelines for the disk diffusion method for C. jejuni and C. coli.

 

The last point of sampling (cold storage) detected 22.6% of positive samples. This is important because from this point the poultry meat is dispatched to the consumers. If we follow the Campylobacter prevalence along the production chain we find reduced prevalence but not eliminated (Zhu et al., 2017).

Presence of resistance genes in C. jejuni

In total 111 of the isolstaes were confirmed as C. jejuni by both the classical method and the multiplex PCR. Three of the isolates were dismissed because of technical issues with the template DNA purity. Therefore, 108 isolates were subjected to further analysis for the detection of resistance genes.

Resistance genes showed different prevalence in the C. jejuni isolates. Highest prevalence was noted for Blaoxa-61 gene (25%) which is lower than the prevalence detected in similar studies (Bardon et al., 2017; Obeng et al., 2012). The analysis for the CmeB and tet(O) genes showed same prevalence (19.4%). The CmeB gene presence (part of the CmeABC operon) in this study was much lower that the confirmed presence in a similar study (Olah et al., 2006) where the authors detected this gene in 85,5% of the C. jejuni isolates. The tet(O) gene has an interesting plasmid location therefore its transfer between the microorganisms like Campylobacters is very possible. In our study the prevalence noted (19.4%) was higher that the prevalence detected in two other studies (Du et al., 2018; Obeng et al., 2012) where the authors confirmed the tet(O) gene in 8.3% and 11.2% of the C. jejuni isolates.

In this study the presence of aadE gene was detected in 13,9% of the C. jejuni isolates. The literature review on this gene usually shows a low prevalence and in several published papers we noted low prevalence (Cantero et al., 2018; Obeng et al., 2012; Wysok et al., 2020; Du et al., 2018) with 6.3%, 0%, 0%, 0.8%, respectively.

The aph-3-1 gene generally has low prevalence in C. jejuni isolates and that was also confirmed in our study. The same prevalence (0%) was confirmed in other studies (Devi et al., 2019) but there are cases when this gene had shown higher prevalence confirmed by Qin et al.(2012) with 7.3% and the study done by Issa et al. (2018) with 3.7%.

Antimicrobial resistance of C. jejuni

The results of the the tests identify that C. jejuni isolates expressed highest antimicrobial resistance towards ciprofloxacin (63% of resistant isolates) and tetracycline (50%). Much lower antimicrobial resistance was detected towards erythromycin (5.6%).

Concerning high level of resistance of Campylobacter jejuni to ciprofloxacin was also confirmed in several other studies through the world ranging from 71 to 98% (Wieczorek et al., 2018; Nguyen et al., 2016; Chen et al., 2010).

Tetracycline resistance in isolates of C. jejuni shows a great variation depending on the study region, climatic conditions and the frequency of usage of this antimicrobial in the feed. We have noted similar rate of prevalence in the study performed in Belgium (Mattheus et al., 2012) with 45.3% prevalence of tet(O) gene. Higher prevalence of this gene in C. jejuni isolates were detected in other studies with prevalence of 77,4 and 98.2% (Nguyen et al., 2016; Bester and Essack, 2008).

Erythromycin is still a first-choice drug in clinical management of the Campylobacteriosis (Rivera-Mendoza et al., 2020). Therefore, it is of vital importance to follow the resistance level of this antimicrobial in Campylobacter isolates. In our study we detected 5.6% of resistant isolates of C. jejuni that is similar to the results obtained in other studies (Gupta et al., 2004; Mattheus et al., 2012) where the authors confirmed 2% and 12.1% of isolates of C. jejuni that were resistant to erythromycin.

Conclusions and Recommendations

This study confirmed high prevalence of Campylobacter jejuni in the broiler meat production chain. This statement is valid both at the farm and the slaughterhouse (evisceration phase and cold storage) in different type of analyzed samples.

We must address the level of C. jejuni prevalence in the cold chamber which is the last stage before the chicken goes on sale therefore posing a great risk to the consumers.

The findings of this study highlight the need for efficient measures to control Campylobacter spp. contamination in the production chain.

The isolates of C. jejuni showed high levels of phenotypic resistance to ciprofloxacin and tetracycline. This fact underlines the need for prudent use of antimicrobials in poultry production to minimize the emergence and spread of antibiotic-resistant Campylobacter spp. strains.

The resistance gene Blaoxa-61 was detected in 25% of the C. jejuni isolates, cmeB and tet(O) genes were present in 19.4%. Lower level of prevalence was confirmed for aadE gene (13,9%) and aph-3-1 gene was not detected in any of the C. jejuni isolates.

Finally, we recommend measures that should be implemented to prevent the occurrence of resistant bacteria or resistance genes in the food chain: reduction of the use of antibiotics, encourage narrow-spectrum specific antibiotic therapy instead of broad spectrum antimicrobials, and replacement of antibiotics with improvements in hygiene and flock management.

Acknowledgements

This research was supported by the Faculty of Veterinary Medicine-Skopje. The authors of this manuscript would like to offer their gratitude to our colleagues Dr. Kiril Krstevski and Dr. Igor Dzadzovski for their scientific advice and technical help.

Novelty Statement

This study is among the first to focus on the prevalence of C. jejuni in the broiler production chain in North Macedonia, subsequently analyzing the antimicrobial resistance towards ciprofloxacin, erythromycin and tetracycline combined with the presence of resistance genes in the confrmed isolates.

Authors’s Contribution

LJA conceived and designed the study and wrote the manuscript.

LJA, ZP, KB and MP performed the experiments.

MP contributed to the final version.

SM and DJ gave critical revision.

PS supervised the project and approved it for publishing.

Conflict of interest

The authors have declared no conflict of interest.

References

Bardoň, J., Pudová, V., Koláčková, I., Karpíšková, R., Röderová, M. and Kolář, M., 2017. Virulence and antibiotic resistance genes in Campylobacter spp. in the Czech Republic. Geny virulence a rezistence k antibiotikům u Campylobacter spp. v České republice. Epidemiologie, mikrobiologie, imunologie: Casopis Spolecnosti pro epidemiologii a mikrobiologii Ceske lekarske spolecnosti J. E. Purkyne, 66(2): 59–66.

Bester, L.A. and Essack, S.Y., 2008. Prevalence of antibiotic resistance in Campylobacter isolates from commercial poultry suppliers in KwaZulu-Natal, South Africa. J. Antimicrob. Chemother., 62(6): 1298–1300. https://doi.org/10.1093/jac/dkn408

Blaser, M.J. and Engberg, J., 2008. Clinical aspects of Campylobacter jejuni and Campylobacter coli infections. In: Nachamkin I, Szymanski CM, Blaser MJ. (ed), Campylobacter. ASM Press, Washington, DC, USA. pp. 99–121.

Bolinger, H. and Kathariou, S., 2017. The current state of macrolide resistance in Campylobacter spp.: Trends and impacts of resistance mechanisms. Appl. Environ. Microbiol., 83(12): e00416-17. https://doi.org/10.1128/AEM.00416-17

Cantero, G., Correa-Fiz, F., Ronco, T., Strube, M., Cerdà-Cuéllar, M. and Pedersen, K., 2018. Characterization of Campylobacter jejuni and Campylobacter coli Broiler Isolates by Whole-Genome Sequencing. Foodborne Pathog. Dis., 15(3): 145–152. https://doi.org/10.1089/fpd.2017.2325

Chen, X., Naren, G.W., Wu, C.M., Wang, Y., Dai, L., Xia, L.N., Luo, P.J., Zhang, Q. and Shen, J.Z., 2010. Prevalence and antimicrobial resistance of Campylobacter isolates in broilers from China. Vet. Microbiol., 144(1-2): 133–139. https://doi.org/10.1016/j.vetmic.2009.12.035

Devi, A., Mahony, T.J., Wilkinson, J.M. and Vanniasinkam, T., 2019. Antimicrobial susceptibility of clinical isolates of Campylobacter jejuni from New South Wales, Australia. J. Glob. Antimicrob. Resist., 16: 76–80. https://doi.org/10.1016/j.jgar.2018.09.011

Di Giannatale, E., Prencipe, V., Colangeli, P., Alessiani, A., Barco, L., Staffolani, M., Tagliabue, S., Grattarola, C., Cerrone, A., Costa, A., Pisanu, M., Santucci, U., Iannitto, G. and Migliorati, G., 2010. Prevalence of thermotolerant Campylobacter in broiler flocks and broiler carcasses in Italy. Vet. Ital., 46(4): 405–423.

Du, Y., Wang, C., Ye, Y., Liu, Y., Wang, A., Li, Y., Zhou, X., Pan, H., Zhang, J. and Xu, X., 2020. Molecular identification of multidrug-resistant Campylobacter species from diarrheal patients and poultry meat in Shanghai, China. Front. Microbiol., 9: 1642. https://doi.org/10.3389/fmicb.2018.01642

EUCAST, 2020. Breakpoint tables for interpretation of MICs and zone diameters. 2020; Version 10.0. http://www.eucast.org.

García-Sánchez, L., Melero, B. and Rovira, J., 2018. Campylobacter in the food chain. Adv. Food Nutr. Res., 86: 215–252. https://doi.org/10.1016/bs.afnr.2018.04.005

Gupta, A., Nelson, J.M., Barrett, T.J., Tauxe, R.V., Rossiter, S.P., Friedman, C.R., Joyce, K.W., Smith, K.E., Jones, T.F., Hawkins, M.A., Shiferaw, B., Beebe, J.L., Vugia, D.J., Rabatsky-Ehr, T., Benson, J.A., Root, T.P. and Angulo, F.J., 2004. NARMS working group. Antimicrobial resistance among Campylobacter strains, United States, 1997-2001. Emerg. Infect. Dis., 10(6): 1102–1109. https://doi.org/10.3201/eid1006.030635

Hansson, I., Sandberg, M., Habib, I., Lowman, R. and Engvall, E.O., 2018. Knowledge gaps in control of Campylobacter for prevention of Campylobacteriosis. Transbound. Emerg. Dis., 65(Suppl 1): 30–48. https://doi.org/10.1111/tbed.12870

Iovine, N.M., 2013. Resistance mechanisms in Campylobacter jejuni. Virulence, 4(3): 230–240. https://doi.org/10.4161/viru.23753

ISO standard 10272-1, 2017. Horizontal method for detection and enumeration of Campylobacter spp. Part 1: Detection method.

Issa, G., Basaran Kahraman, B., Adiguzel, M.C., Yilmaz Eker, F., Akkaya, E., Bayrakal, G.M., Koluman, A. and Kahraman, T., 2018. Prevalence and antimicrobial resistance of thermophilic Campylobacter isolates from raw chicken Meats. Kafkas Univ. Vet. Fak. Derg., 24(5): 701-707.

Luangtongkum, T., Jeon, B., Han, J., Plummer, P., Logue, C.M. and Zhang, Q., 2009. Antibiotic resistance in Campylobacter: Emergence, transmission and persistence. Future Microbiol., 4(2): 189–200. https://doi.org/10.2217/17460913.4.2.189

Mattheus, W., Botteldoorn, N., Heylen, K., Pochet, B. and Dierick, K., 2012. Trend analysis of antimicrobial resistance in Campylobacter jejuni and Campylobacter coli isolated from Belgian pork and poultry meat products using surveillance data of 2004-2009. Foodborne Pathog. Dis., 9(5): 465–472. https://doi.org/10.1089/fpd.2011.1042

Nguyen, T.N., Hotzel, H., Njeru, J., Mwituria, J., El-Adawy, H., Tomaso, H., Neubauer, H. and Hafez, H.M., 2016. Antimicrobial resistance of Campylobacter isolates from small scale and backyard chicken in Kenya. Gut Pathog., 8(1): 39. https://doi.org/10.1186/s13099-016-0121-5

Obeng, A.S., Rickard, H., Sexton, M., Pang, Y., Peng, H. and Barton, M., 2012. Antimicrobial susceptibilities and resistance genes in Campylobacter strains isolated from poultry and pigs in Australia. J. Appl. Microbiol., 113(2): 294–307. https://doi.org/10.1111/j.1365-2672.2012.05354.x

Olah, P.A., Doetkott, C., Fakhr, M.K. and Logue, C.M., 2006. Prevalence of the Campylobacter multi-drug efflux pump (CmeABC) in Campylobacter spp. Isolated from freshly processed Turkeys. Food Microbiol., 23(5): 453–460. https://doi.org/10.1016/j.fm.2005.06.004

Perez-Arnedo, I. and Gonzalez-Fandos, E., 2019. Prevalence of Campylobacter spp. in poultry in three Spanish farms, a slaughterhouse and a further processing plant. Foods (Basel, Switzerland), 8(3): 111. https://doi.org/10.3390/foods8030111

Qin, S., Wang, Y., Zhang, Q., Chen, X., Shen, Z., Deng, F., Wu, C. and Shen, J., 2012. Identification of a novel genomic island conferring resistance to multiple aminoglycoside antibiotics in Campylobacter coli. Antimicrob. Agents Chemother., 56(10): 5332–5339. https://doi.org/10.1128/AAC.00809-12

Rivera-Mendoza, D., Martínez-Flores, I., Santamaría, R.I., Lozano, L., Bustamante, V.H. and Pérez-Morales, D., 2020. Genomic analysis reveals the genetic determinants associated with antibiotic resistance in the zoonotic pathogen Campylobacter spp. distributed globally. Front. Microbiol., 11: 513070. https://doi.org/10.3389/fmicb.2020.513070

Saleha, A.A., 2002. Isolation and characterization of Campylobacter jejuni from broiler chickens in Malaysia. Int. J. Poult. Sci., 1(4): 94-97. https://doi.org/10.3923/ijps.2002.94.97

Schets, F.M., Jacobs-Reitsma, W.F., van der Plaats, R., Heer, L.K., van Hoek, A., Hamidjaja, R.A., de RodaHusman, A.M. and Blaak, H., 2017. Prevalence and types of Campylobacter on poultry farms and in their direct environment. J. Water Health, 15(6): 849–862. https://doi.org/10.2166/wh.2017.119

Schwan, P., 2010. Prevalence and antibiotic resistance of Campylobacter spp. in poultry and raw meat in the Can Tho Province, Vietnam. PhD thesis. Swedish University of Agricultural Sciences, Uppsala, Sweden

Shen, Z., Wang, Y., Zhang, Q. and Shen, J., 2018. Antimicrobial resistance in Campylobacter spp. Microbiol. Spect., 6(2): 10.1128/microbiolspec.ARBA-0013-2017. https://doi.org/10.1128/microbiolspec.ARBA-0013-2017

Sibanda, N., McKenna, A., Richmond, A., Ricke, S.C., Callaway, T., Stratakos, A.C., Gundogdu, O. and Corcionivoschi, N., 2018. A review of the effect of management practices on Campylobacter prevalence in poultry farms. Front. Microbiol., 9: 2002. https://doi.org/10.3389/fmicb.2018.02002

Silva, J., Leite, D., Fernandes, M., Mena, C., Gibbs, P.A. and Teixeira, P., 2011. Campylobacter spp. as a foodborne pathogen: A review. Front. Microbiol., 2: 200. https://doi.org/10.3389/fmicb.2011.00200

Wang, G., Clark, C.G., Taylor, T.M., Pucknell, C., Barton, C., Price, L., Woodward, D.L. and Rodgers, F.G., 2002. Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J. Clin. Microbiol., 40(12): 4744–4747. https://doi.org/10.1128/JCM.40.12.4744-4747.2002

Whitehouse, C.A., Zhao, S. and Tate, H., 2018. Antimicrobial resistance in Campylobacter Species: mechanisms and genomic epidemiology. Adv. Appl. Microbiol., 103: 1–47. https://doi.org/10.1016/bs.aambs.2018.01.001

Wieczorek, K., Wołkowicz, T. and Osek, J., 2018. Antimicrobial resistance and virulence-associated traits of Campylobacter jejuni isolated from poultry food chain and humans with diarrhea. Front. Microbiol., 9: 1508. https://doi.org/10.3389/fmicb.2018.01508

Wysok, B., Wojtacka, J., Hänninen, M.L. and Kivistö, R., 2020. Antimicrobial resistance and virulence-associated markers in Campylobacter strains from diarrheic and non-diarrheic humans in Poland. Front. Microbiol., 11: 1799. https://doi.org/10.3389/fmicb.2020.01799

Zhang, P., Zhang, X., Liu, Y., Jiang, J., Shen, Z., Chen, Q. and Ma, X., 2020. Multilocus sequence types and antimicrobial resistance of Campylobacter jejuni and C. coli isolates of human patients from Beijing, China, 2017-2018. Front. Microbiol., 11: 554784. https://doi.org/10.3389/fmicb.2020.554784

Zhu, J., Yao, B., Song, X., Wang, Y., Cui, S., Xu, and Gong, P., 2017. Prevalence and quantification of Campylobacter contamination on raw chicken carcasses for retail sale in China. Food Cont., 75: 196–202. https://doi.org/10.1016/j.foodcont.2016.12.007