Research Article

Developed One-step Reverse Transcription Loop-Mediated Isothermal Amplification (Rt-Lamp) Assay for Detection of Strawberry Latent Ring Spot Virus

Ahmed A. Kheder

Virus and Phytoplasma Research Department, Plant Pathology Research Institute, AgriculturalResearch Center, Giza, Egypt.

Received | January 04, 2021; Accepted | January 24, 2021; Published | January 28, 2021

*Correspondence | Ahmed A. Kheder, Virus and Phytoplasma Research Department, Plant Pathology Research Institute, Agricultural Research Center, Giza, Egypt; Email: ahmed.zakaria@arc.sci.eg

Citation | Ahmed A. Kheder. 2021. Developed one-step reverse transcription loop-mediated isothermal amplification (rt-lamp) assay for detection of Strawberry Latent Ring Spot Virus. Journal of Virological Sciences, 9(1): 1-13.

DOI | https://dx.doi.org/10.17582/journal.jvs/2021/9.1.1.13

Keywords | Strawberry latent ring spot virus, Virus incidence, RT-PCR, RT-LAMP

Introduction

Strawberry (Fragaria ananassa Duch) is widely grown hybrid species of the genus Fragaria spp, it is considered one of the most important members of the family Rosaceae. Its fruit is rich in vitamins A, B and C, potassium, calcium, magnesium, iron, sulfur and phosphorus. Strawberry plants were first bred in France in the 1750s via a cross of Fragaria virginiana and Fragaria chiloensis. Fragaria vesca woodland strawberry was the first strawberry species cultivated in 17th century, have been replaced with Fragaria ananassa in commercial production (Welsh, 2008). Egypt is among the great’s countries that produce strawberry and is considered as the fourth-largest producer in the world after the United States, Turkey and Spain by yields per hectare of about 390966 hg/ha the total harvested area reached 11772 hectares with production about 460245 tons in 2019 (FAO, 2019), the planting area has been annually increased. Strawberry has become one of the most economically important vegetable crops in El-Menoufia, El-Qalyubia, El-Sharkia, El-Beheira and El-Ismailia governorates. Strawberry plants are propagated vegetatively and it attacked with many viruses and virus-like disease during plant propagation and fruit production stages. Strawberry plants are usually symptomless when infected with one virus and often in mixed infections having serious effects on vigor and yield (Pisi, 1986; Martin, 2004 and Tzanetakis, 2006). Strawberry latent ring spot virus (SLRSV), first characterized in Scotland from strawberry and raspberry by Lister (1964) and is conceded one of the most common viruses of cultivated strawberry plants and occurs where ever they are grown and was classified as unassigned species in family Secoviridae (Mayo and Jones, 1999). Recently, this virus is classified as a member of genus Stralarivirus belonging to family Secoviridae (Dullemans et al., 2020) with a worldwide distribution, producing symptoms that includes mottling, mosaic, ring spot and systemic necrosis; often particularly in the late stage infections are symptomless (Murant et al., 1981). SLRSV infects a wide range of hosts including many economically crops such as small fruit (strawberry, blackberry and raspberry), stone fruit (plum, cherry and peach), vegetables (celery and parsley) grapevine, olive, ornamental plants (lily and rose) and tree species (Aesculus and Robinia spp.) (Schmelzer, 1969; belli et al., 1980; Credi et al., 1981; Faggioli et al., 2005; Mazyad et al., 2012 and El-Morsy et al., 2017). The virus can be transmitted with plant sap by mechanical inoculation, through infected seeds, pollen and by soil-inhabiting nematodes Xiphinema diversicaudatum and X. Coxi (Murant, 1974). SLRSV appears as isometric particles 30nm in diameter (Faggioli et al., 2002), has a bipartite genome composed of two liner positive-sense single-stranded RNA molecules, RNA 1 (Mr 2.9 x 106), it encodes the proteins that are important in replication and RNA 2 (Mr 1.4 x 106), which encodes the proteins that are important in cell-cell movement and evasion of cellular defenses (Mayo et al., 1982). In Egypt, SLRSV has been detected using ELISA and reverse transcription-polymerase chain reaction (RT-PCR) (Mazyad et al., 2012 and El-Morsy et al., 2017). Due to ELISA technique and/or RT-PCR reaction, the reaction time for these methods is time-consuming and laborious, requiring at lease 10hrs to obtain results, also gradient of cycling temperature between three amplification steps as a consequence, they are inconvenient for rapid diagnosis and point-of-care applications (Parida et al., 2008 and Sidoti et al., 2013). Attempts to find differences in coat protein of the different isolates of SLRSV were limited due to the lack of data in GenBank (Borodynko, et al., 2007). In general, Loop-mediated isothermal amplification (LAMP) technique was found to be 10-100 fold more sensitive than PCR with a detection limit of 0.01-10 pfu of the virus (Thai et al., 2004) and The specificity of the LAMP amplification is referred to the six sets of primers spanning eight distinct sequences of the target gene that are being used for amplification. In this study, SLRSV was isolated and characterized based on serological, biological, and molecular studies and developed molecular tools based on RT-LAMP for rapid and specific SLRSV detection compared with standard RT-PCR detection method.

Materials and methods

Source of virus isolate and virus incidence

Strawberry leaves showing virus-like symptoms and others symptomless were collected from commercial strawberry fields located in El-Menoufia, El-Qalyubia, El-Sharkia, El-Beheira and El-Ismailia governorates during the spring and early summer seasons of 2018- 2020. About 693 samples were collected from different locations of strawberry cvs. (Festival, Selva, Camarosa and Florida). The collected leaf samples were tested by direct enzyme-linked immunosorbent assay (DAS-ELISA) as described by Clark and Adams (1977) using commercial antisera

 

Table 1: Sequence of degenerate primers for subgroup detection and sense and antisense specific primers used in RT-PCR and RT-LAMP and their nucleotide positions in the genome.

Primer Code	Sequences (‘5-3’)	Subgroup/ Virus	Lo-cation /po-sition	Amplifi-cation product	References
Conventional RT-PCR
Nepo-A (s/a)	GGHDTBCAKTMYSARRARTGG	Subgroup A	CP-RNA2	255 bp	Digiaro et al. (2007)
	TGDCCASWVARYTCYCCATA
Nepo-B (s/a)	ATGTGYGCHACYACWGGHATGCA	Subgroup B	CP-RNA2	390 bp
	TTCTCTDHAAGAAATGCCTAAGA
Nepo-C (s/a)	TTRKDYTGGYKAAMYYCCA	Subgroup C	UTR-RNA1	640 bp
	TMATCSWASCRHGTGSKKGCCA
SLRSV-F(sp)	CCTCTCCAACCTGCTAGACT	SLRSV	CP-RNA2	497 bp	Martin et al., (2004)
SLRSV-R(sp)	AAGCGCATGAAGGTGTAACT
Loop-mediated isothermal amplification primers
SLRSV F3	TTCTTATGGACAACAGGATCG	SLRSV	CP-RNA2		This study
SLRSV B3	CCACATTACTGTTGATCGGA
FIP(F1c+F2)	TCCACTAGCTTCCGCCTCA-TCCAAAGTGCTCCTTTCAC
BIP(B1c+B2)	AGTTGGTTCCTGCAGCCTCC-CTGGTAGAGGAATGCTCT
LoopF	CCAGTATGTTGTTTGCATGGG
LoopB	TGGTGGAACAGAGGCAATC

*sp: specific; s: sense; a: antisense; B (C+G+T); D (A+G+T); H (A+C+T); M (A+C); R (A+G); S (C+G); W (A+T); Y (C+T); K (G+T).

 

(Loewe Biochemica, Sauerlach, Germany). Positive samples were confirmed by RT-PCR.

Mechanical transmission and host rang

Strawberry leaf samples which reacted positively with DAS-ELISA were used as source of virus and used for mechanical inoculation onto ten different plant species belonging to families Amaranthaceae, Chenopodiaceae, Cucurbitaceace, Lamiaceae, Leguminosae, Rosaceae and Solanaceae and kept under greenhouse conditions 25°C±5 and 65±5% RH for 2-3weeks and were observed for symptoms development. All mechanically inoculated plants were examined by ELISA and confirmed by both RT-PCR and RT-LAMP. Isolate used in this study was obtained by the single local lesion isolate method, a single local lesion formed on Ch. quinoa was used to inoculate Mentha spicata leaves. Infected Mentha spicata plants which reacted positively to SLRSV were served as source of virus inoculum (Boonham and wood, 1998).

Molecular detection

Viral RNA extraction and one-step RT-PCR amplification

Total RNA was extracted from about 150mg fresh leaf tissues of healthy and infected strawberry plants as well as mechanically inoculated plants of Gomphrena globose, Ch. quinoa wild, Cucurbita pepo, Mentha spicata, Vicia faba, Fragaria ananassa cv. Festival, Datura stramonium, Lycopersicon esculentum c.v Castle Rock, Petunia hybrida and N. tabacum cv. White Burley, then re-suspended in 50µl of RNase-free water as described in the manufacture instructions of Geneaid RNA extraction mini Kit (Geneaid - Taiwan). The RNA quality and quantity were assessed using a NanoDrop 2000 spectrophotometer (ThermoFisher Scientific, Waltham, Massachusetts, USA), and the final concentration was adjusted to approximately 150 ng/µl. Reverse transcription-polymerase chain reaction (RT-PCR) was done with reverse VersoTM one-step RT-PCR Reddy Mix Kit (Thermo Scientific) according to the manufactory instruction. RT-PCR assay with degenerate primers for detection of nopovirus subgroups were performed in 25µl final volume containing 12.5µl of one-step RT-PCR master mix, 5µl of nuclease-free water, 3µl of total RNA, 1.5µl (10µM) sense and antisense of each degenerate primers (Table 1), 1.25µl RT-Enhancer and 0.25µl Verso enzyme. Different combinations of denaturing and annealing conditions (temperature and time of treatment)

 

were used with each set of primers for determining the optimal operative conditions for PCR amplification. Complementary DNA (cDNA) synthesis was done at 50°C for 15min, 94°C for 5 min; followed by 35 cycles of 94°C, 35 sec, 50°C, for 45 sec and 72°C for 1min and a final extension for 7 min at 72°C for subgroups A, B and C. Grapevine fanl eaf virus (GFLV) and Tomato ring spot virus (ToRSV) were provided from Plant Pathology Research Institute, ARC, Egypt, and were used as positive control for nepovirus subgroups A and C respectively. RT-PCR assay with specific primer was done in 25µl total volume containing 12.5µl of one-step PCR master mix, 5µl of nuclease-free water, 3µl of total RNA, 1.5µl (10µM) specific forward and reverse primers in Table (1), 0.25µl Verso enzyme and 1.25µl RT-Enhancer. Synthesis of (cDNA) was done at 50°C for 15min, 94°C for 3 min; followed by 40 cycles of 94°C, 20 sec, 52°C, for 30 sec and 72°C for 30 sec and a final extension for 5 min at 72°C. 6µl of the amplified products were loaded in 1.5% agarose gel prepared in TAE buffer (1x), stained with EZview stain (Biomatik- USA) and visualized using a UV transilluminator. The size of the amplified products was estimated using 100bp DNA Ladder (Biomatik - USA).

Sequencing and phylogenetic analysis

The RT-PCR product was purified using Gel/PCR DNA Fragments Kit (Genaid –Taiwan), and direct sequenced on an ABI automatic sequencer (Applied Biosystem, NJ, USA). Nucleotide and amino acid sequences were compared with the sequences available in the GenBank database. The multiple sequence alignments were performed using ClustalW (Thompson et al., 1994). The alignments were used to calculate pairwise genetic distances by Kimura’s two-parameter method. Phylogenetic analysis was carried using the Maximum Likelihood method implemented with Molecular Evolutionary Genetics Analysis software (MEGA) version X (Kumar et al., 2018). Bootstrap values for phylogenetic comparisons are based on 1000 pseudoreplicates.

Real-time loop-mediated isothermal amplification (RT-LAMP) assay LAMP primers were designed using LAMP Designer 1.12 software program. Based on the alignment of five isolates of SLRSV coat protein sequence available in GenBank (Accession Nos. X77466, DQ324374.1, MF796996.1, AY438666.1 and AY860979.1) with Egyptian isolate SLRSV-Eg (Accession No. MT648777.1). Alignment was

constructed with MEGA X software to identify conserved SLRSV genomic regions. A set of six primers for the viral coat protein gene comprising two outer (F3 and B3), two inner (FIP and BIP) and two loop primers (FLP and BLP), that recognize eight distinct regions on the target sequence was designed (Figure 1). The primer sets used in this study are listed in Table 1. RT-LAMP was carried out in 25µl reaction containing 15µl Isothermal Master Mix (OptiGene, Horsham, UK) contains fluorescence dye, 200 nM each external primer (F3 and B3), 2µM each internal primer (FIP and BIP), 1µM each loop primer (F-loop and B-loop), 1.2 units Thermo-Script reverse transcriptase (Life Technologies, CA, USA) and 1 µl RNA. Reaction mixtures were incubated at 50°C for 10 min, then 60°C for 30 min, the reactions were subjected to a slow annealing step (0.05°C/s) from 95°C to 75°C with fluorescence monitoring. Reactions containing GFLV, ToRSV and water instead of SLRSV-RNA were used as the negative control in each run (Tomlinson et al., 2013). To assess the sensitivities of

 

Table 2: Incidence of Strawberry latent ringspot virus (SLRSV) infection in strawberry plants in different location in Egypt.

the RT-LAMP assay and the standard RT-PCR approach, the concentration of total RNA from highly infected strawberry plants with SLRSV was adjusted to 100ng/µl then serially diluted. RT-LAMP reactions were done using 1µl of serially diluted templates as well as conventional one-step RT-PCR. The amplified products of RT-LAMP and RT-PCR were analyzed by electrophoresis using 1.5% agarose gels containing EZview stain (Biomatik - USA) and visualized using a UV transilluminator. All RT-LAMP runs were performed at least twice.

Results and Discussion

The virus under investigation was isolated from naturally infected strawberry plants in Egypt showing virus-like symptoms and others symptomless (Figure 2 A and B) and identified on the basis of symptomatology, mechanical transmission, serology, and molecular assays. All data obtained confirmed that the virus under investigation was Strawberry latent ring spot virus (SLRSV).

Source of virus isolate and virus incidence

Virus incidence was checked during the spring and early summer seasons of 2018- 2020 in strawberry fields in five different governorates, the viruses infection were detected using DAS-ELISA, among those

Table 3: Reaction of some inoculated host plants to SLRSV infection.

viruses, SLRSV was found to be the most prevalent virus in strawberry mean cultivated areas, data in (Table 2) indicated that in total, 41 out of 693 (5.94%) strawberry plants tested positive to SLRSV and the average of infection in strawberry cultivars Festival, Selva, Camarosa and Florida were about 7.0%, 6.4%, 5.4% and 4.8% respectively. Also, the percentages of infection were about 7.3%, 6.7%, 5.4%, 5.16% and 2.63% in El-Qalyubia, El-Beheira, El- Menoufia, El-Sharkia and El-Ismailia in tested samples respectively. The samples which gave positive results with DAS-ELISA were confirmed by RT-PCR.

Mechanical transmission and Host rang

Ten plant species belonging to seven families: Amaranthaceae, Chenopodiaceae, Cucurbitaceace, Lamiaceae, Leguminosae, Rosaceae and Solanaceae, were mechanically inoculated with the virus preparation to determine the host range. Data presented in Table (3) and (Figure 2), illustrated the reaction of mechanically inoculated plants for SLRSV-Eg infection under greenhouse conditions (25°C±5 and 65±5% RH). SLRSV-Eg isolate produced vein banding on Mentha spicata; mottling systemic local lesion on inoculated leaves of Ch. quinoa wild; chlorotic local lesion on Nicotiana tabacum cv. White Burley and mosaic on the inoculated leaves of Vicia faba plants these symptoms were observed after 15, 18, 20 and 22 days post-inoculation (dpi) respectively with different infection rates. Results were confirmed by DAS-ELISA, RT-PCR and RT-LAMP assays. Moreover, inoculated Fragaria ananassa cv. Festival leaves showed no symptoms as well as ELISA, RT-PCR and RT-LAMP assays succeeded to detect the virus (20dpi). while, inoculated Datura stramonium, Gomphrena globose, Cucurbita pepo, Petunia hybrid and Lycopersicon esculentum cv. Castle Rock were not infected with the virus and ELISA, RT-PCR and RT-LAMP assays failed to detect the virus from these hosts 30dpi.

Molecular detection

RT-PCR and sequence analysis

The extracted RNA from naturally infected strawberry plant and all the inoculated plants were tested for SLRSV infection by RT-PCR. Amplicon of 497bp was obtained using specific primers SLRSV-F and SLRSV-R for detection of SLRSV, designed to amplify fragment of CP-RNA2 of SLRSV-Eg isolate. RT-PCR product of the expected size were obtained from four herbaceous plant species, as well as symptomatic and asymptomatic strawberry plants (Table 3 and Figure 3). Electrophoresis analysis of RT-PCR product showed a single amplified fragment of about 497bp presumably from the part of coat protein gene of SLRSV (Figure 3). Direct sequencing of the amplicon confirmed that is SLRSV and the consensus sequence obtained was deposited in GenBank (accession number MT648777.1). Moreover, No amplicons were obtained when using the nepovirus degenerate primers Nepo-A (s/a), Nepo-B (s/a) and Nepo-C (s/a) while, the one-step RT-PCR reactions generated the expected amplicons for all positive controls (Figure 3). Data confirmed that no mixed infection with nepovirus group such as Grapevine fanleaf virus (GFLV), Tomato ring spot virus (ToRSV), Arabis mosaic virus (ArMV), Tomato black ring virus (TBRV) and Raspberry ring spot virus (RPRSV).

 

.

Phylogenetic analysis was carried out to compare sequences across the region of CP-RNA2 (497bp) from the Egyptian isolate (SLRSV-Eg) with other SLRSV isolates overseas as shown in (Figure 4 and Table 4), a Pairwise comparisons of the 497bp nucleotide sequence revealed that the USA (MEN454) and Canada isolates indicate 99.5% homology and 97.8% amino acid sequence identities. In comparison to Poland isolate (Robinia 14-027) it shared 65.9% nucleotide 90.4% amino acid sequence identities. Pairwise comparisons showed that the USA isolates (SLRSV- Mint454 and NCGR_MEN454.001) had 99% and 98.6% nucleotide identities and 96.4 and 97.8% amino acid sequence identities respectively. While, New Zealand isolates Rubus14-022, 2-36, 2-41 and 6-6 were distinct from the Egyptian isolate and shared 96.5%, 94.5%, 82.9% and 82.9% nucleotide identities respectively, both Polish isolates N31 and W16 shared 76.6%.

Detection of SLRSV by RT-LAMP using the designed primer sets

The CP-RNA2 gene of SLRSV was chosen as the amplification target. SLRSV detection was carried out successfully using real-time RT-LAMP assay on healthy and infected strawberry plants as well as mechanically inoculated plants, the obtained results revealed that the CP-RNA2 gene of SLRSV isolate can be amplify rapidly within 15-40 minutes based on virus concentration (Figure 5), the sensitivity was gradually boosted by using 50°C for 10 min for cDNA synthesis followed by a single incubation temperature of 60°C for 30 min then slow annealing step (0.05°C/s) from 95°C to 75°C. Amplification products were visualized by 1.5% agarose gel electrophoresis exhibited typical ladder-like pattern of LAMP products and no visible amplification product was observed from RNA isolated from GFLV, ToRSV and healthy strawberry plants as well as water controls as shown in (Figure 5 a and b), demonstrating the high specificity of RT-LAMP primers for detection of the virus. Obtained results confirmed that the RT-LAMP assay allows detection of SLRSV in 10-4 dilution of total RNA, while the detection limit of the conventional RT-PCR was about 10-3 as seen in Figure 5b. Therefore, the RT-LAMP assay is 10 times more sensitive than conventional RT-PCR in addition to the important advantages of the RT-LAMP assay as the very short detection time furthermore it doesn’t require expensive equipment.

 

The current study dealt with characterization and detection of isolate of Strawberry latent ring spot virus (SLRSV) in strawberry plants in Egypt showing virus-like symptoms and others symptomless and identified on the basis of symptomatology, mechanical transmission, serology, and molecular assays. During the spring and early summer seasons of 2018- 2020 in strawberry fields in five different governorates, the viruses infection were detected using DAS-ELISA. Although, the serological methods are simple and easy to perform, false results can occur due to the instability and altered distribution of the virus in the host plants, Moury et al. (2000), reported that RT-PCR can exceed DAS-ELISA in sensitivity to detect plant viruses especially with symptomless hosts, as well as the reaction time for these methods is time-consuming and laborious, requiring at lease 10hrs to obtain results reported by Parida et al. (2008). The LAMP assay has been used for the molecular detection and diagnosis of many pathogens, including bacteria, viruses, Spiroplasma (Haj Ali, M. 2020), fungi, and parasites responsible for plant, animal, and human diseases (Przewodowska et al., 2015). During the spring and early summer seasons of 2018- 2020 virus incidence was checked in strawberry fields in five different governorates using DAS-ELISA, among those viruses, SLRSV was found to be the most prevalent virus in strawberry mean cultivated areas. The incidence results showed that dissemination of the virus was varied due to locations, moreover all tested cultivars were susceptible to infection. These results are in agreement with Mazyad et al. (2014) and El-Morsy et al. (2017) in Egypt, which found that SLRSV is limited in the main strawberry growing areas checked by DAS-ELISA and the virus infection varied from region to region as well as from season to season. Also, the obtained results contrasted with Everett et al. (1994) they identified SLRSV in a single sweet cherry trees and was thought to be rare in New Zealand. This virus was detected with low incidence

 

Table 4: Comparison of the nucleotide and Amino acid sequences identities of Strawberry latent ring spot virus (SLRSV) isolated in the present study (SLRSV-EG, Acc. No. MT648777.1) with the corresponding sequences available in the GenBank database.

Accession No.	Country	Isolate	Host Plant	N.A Id %	A.A Id%
MT648777.1	Egypt	SLRSV-EG	Fragaria ananassa cv. Festival
AY438666.1	USA	MEN454	Mentha x gentilis 'Variegata	99.5%	97.8%
AY461735.1	Canada	Strawberry isolate	Fragaria X ananassa cv. Totem	99.5%	97.8%
HQ456535.1	USA	Mint454	Mentha x gracilis Sole	99.0%	96.4%
AY860979.1	USA	NCGR_MEN454.001	Mentha x gentilis 'Variegata	98.6%	97.8%
MF796996.1	New Zealand	Rubus14-022	Cucumis sativus	96.5%	97.8%
KF695116.1	New Zealand	2-36	Vaccinium darrowii	94.5%	97.8%
KF695117.1	New Zealand	2-41	Vaccinium darrowii	82.9%	97.8%
KF695119.1	New Zealand	6-6	Vaccinium darrowii	82.9%	97.8%
DQ324374.1	Poland	N31	Robinia pseudoacacia	76.6%	97.1%
DQ324375	Poland	W16	Robinia pseudoacacia	76.6%	97.1%
X77466	UK	Hampshire H	Cherry	73.3%	94.2%
X75165	New Zealand	flowering cherry	Cherry	71.3%	93.8%
HQ456537	USA	Mint 515	Mentha arvensis L.	67.1%	91.2%
DQ324376.2	Poland	Gorz2	Robinia pseudoacacia	66.3%	90.4%
HQ456536	USA	Mint 514	Mentha arvensis L.	66.9%	91.2%
MF797006.1	Poland	Robinia_14-027	Robinia pseudoacacia	65.9%	90.4%

*N.A Id% = Nucleotide Acid sequence identities % * A.A Id% = Amino Acid sequence identities %

 

in olive plants (Godena et al., 2016), while incidence of varied from 0.3% in Lebanon (Fadel et al., 2005), 6.7% in Croatia (Bjeliš et al., 2007) and 29.2% in Italy (Saponari et al., 2002). The severity of the virus was assessed visually by developing symptoms, different types of symptoms have been observed associated to virus infection. Several studies have confirmed the previously described symptom pattern on different host plants. Previous studies cleared that the virus infects a broad range of hosts, including many economically important crops and is easy to be transmitted via infected sap to the tested host plants and induced symptoms, also, provided that SLRSV is an economically important virus due to its extensive host range and the yield losses it can cause. Similar results were obtained by Borodynko et al. (2007), Mazyad et al. (2014) and El-Morsy et al. (2017), who used the same techniques (DAS-ELISA and RT-PCR) for virus detection and host range. Also, These results are in agreement with those mentioned by Richmond et al. (1998), Martin et al. (2004), Postman et al. (2004) and Tzanetakis et al. (2006), study the mechanical transmission which reported that SLRSV was considered a quarantine virus in the United States until its recent identification in both strawberry and mint nurseries where the soil was treated with methyl bromide to eliminate nematode vestors and it had thought that the virus may be transmitted by insect vector but transmission studies failed to demonstrate transmission of the virus. Everett et al. (1994), suggested that an alternative mode of spread may be due to cultivation practices (e.g., grafting or vegetative propagation by cutting and or using infected materials or tools). Moreover, SLRSV was detected in a much wider range of hosts belong to different plant families, including Ranunculaceae, Rosaceae, Balsaminaceae, Solanaceae, and Melastomataceae. Tang et al. (2013) found that the reverse inoculation from SLRSV-infected C. quinoa to healthy impatiens plants resulted in a symptomless infection and reported that the possibility of latent infections may explain why SLRSV has gone undetected in a wider host range and were also found to be easier to transmit onto indicator plants and induce symptoms. In the present study obtained data confirmed that no mixed infection with nepovirus group such as Grapevine fanleaf virus (GFLV), Tomato ring spot virus (ToRSV), Arabis mosaic virus (ArMV), Tomato black ring virus (TBRV) and Raspberry ring spot virus (RPRSV). This result was similar to the previous results obtained Digiaro et al. (2007) who used the same primer sets and reported that, none of the three nepovirus degenerate primer sets were able to detect SLRSV in infected tissues, these data confirming the molecular distance of this virus from nepovirus species. Also, agreed with Dullemans et al. (2020) who supported the assignment of SLRSV to a new genus in the family Secoviridae, for which the name “Stralarivirus” is proposed based on high-throughput sequencing (HTS) data analysis. Moreover, RT-PCR product of 497bp was obtained using specific primers SLRSV-F and SLRSV-R for detection of SLRSV, designed to amplify fragment of CP-RNA2 of SLRSV-Eg isolate. These result are in agreement with Martin et al. (2004), Mazyad et al. (2014) and El-Morsy et al. (2017), who had used the same primer and got same results. Direct sequencing of the amplicon confirmed that is SLRSV. Moreover, phylogenetic analyses of sequences of SLRSV-CP showed a high level of diversity about 65.9% – 99.5% nucleotide sequences and 90.4% - 97.8% amino acid sequence identities among the sixteen SLRSV-isolates from different parts of the world. Obtained results are in contrast with Mazyad et al. (2012) who reported that SLRSV Egyptian isolate showed a very low identity that ranged between 80-85% when compared with different SLRSV isolates available in GenBank. In contrast El-Morsy et al. (2017). Stated that SLRSV Egyptian isolate shard 99%, 84%, 83% and 80% identity with Poland, USA, UK, and New Zealand isolates respectively. Attempts to find differences in coat protein of the different isolates were limited due to the lack of data in GenBank. Also, both of the two Egyptian isolates which previously detected by Mazyad et al. (2012) and El-Morsy et al. (2017) are not available in GenBank database. Therefore, further studies, comprising of high-throughput sequencing (HTS) and/or complete nucleotide sequence are recommended to obtain more accurate homology between our isolate with other available SLRSV isolates. SLRSV control strategies have focused on the development of effective diagnostic methods aimed at early detection. Recently, nucleic acid-based amplification methods crave low expenses, rapid, specific and simple in comparison with traditional methods. LAMP does not require a thermal cycler or analysis software and can be done using water bath (Parida et al., 2008 and Sriworarat et al., 2015). These features of LAMP amplification assay make it efficient for detecting many pathogenic organisms including virus, bacteria, protozoa, Spiroplasma and fungi (Karanis and Ongerth, 2009; Mori and Notomi, 2009 and Haj Ali M., 2020). Therefore, LAMP assay will be a useful tool for on-site, rapid, reliable, and sensitive, detection of SLRSV in infected plants and diagnosis in quarantine. RT-LAMP is a powerful and flexible tool for monitoring microbial pathogens and shown to have superior sensitivity to DAS-ELISA and RT-PCR, in addition to symptoms or identification of infected materials in a wide range of hosts. Obtained results clearly concluded that the sensitivity of the RT-LAMP protocol was tenfold higher than that of conventional RT-PCR. These results corresponds with Liu et al. (2010), who reported that the detection limit of the RT-LAMP method for tobacco mosaic virus detection was 100 times higher than that of RT-PCR and demonstrate that the method is stable, sensitive and specific. These data in agreement with RT-LAMP sensitivity reports for other plant viruses of Zong et al. (2014), Przewodowska et al. (2015), Budziszewska et al. (2016), Kim et al. (2016) and Haj Ali M. (2020), these data indicate that the detection limit for these methods may be comparable. In contrast with Soliman and El-Matbouli (2006) who found that the detection limit of the RT-LAMP assay was similar to the commonly used RT-PCR method and concluded that both methods detected viral hemorrhagic septicaemia virus (VHS) RNA at a dilution of 10-6 .

Conclusion

The present study showed that SLRSV detected in five governorates, associated with asymptomatic movement of infected plants from nurseries production that already have a problem related with that current SLRSV-Eg isolate. Symptoms development of SLRSV varied depending on the host plants, vein banding, mottling systemic local lesion and mosaic are some of symptoms exhibited by the current isolated virus. The coat protein gene of the four SLRSV-Eg isolate was submitted to GenBank under the accession number MT648777.1. RT-LAMP assay for detection of SLRSV is cost-effective, efficient, easy to perform, rapid and appropriate for early detection and could be successful tool for monitoring of plant virus diseases and in quarantine. The sensitivity of RT-LAMP is equivalent to or better than that of one-step RT-PCR. In addition to RT-LAMP doesn’t require expensive equipment’s (e.g., thermal cycler, and it may be done successfully using water bath or thermal block.

Conflict of interest

The authors have declared no conflict of interest.

References

Belli, G., Fortusini, A., and Vegetti, G. (1980). Properties of a strain of Strawberry latent ring spot virus, associated with a rosetting disease of peach in northern Italy. Acta Phytopathol. Acad. Sci. Hung. 15:113-117.

Bjeliš M., Loconsole G., Saponari M., (2007). Nazočnost virusa u maslinicima Hrvatske. Pomologia Croatica 13(3): 165-172.

Boonham N., Wood K.R. (1998). Assaying Levels of Virus with Local Lesion Hosts. In: Foster G.D., Taylor S.C. (eds) Plant Virology Protocols. Methods in Molecular Biology™, vol 81. Humana Press

Borodynko, N., Hasiow, B., Figlerowicz, M., and Pospieszny, H. (2007). Identification of the new strain of Strawberry latent ring spot virus isolated from black locust (Robinia pseudoacacia L.). J. Phytopathol., 155(11‐12), 738-742.

Budziszewska, M., Wieczorek, P., and Obrępalska-Stęplowska, A. (2016). One-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) for detection of tomato torrado virus. Archi. Virol., 161(5), 1359-1364.

Clark M.F. and Adams A.N. (1977). Characteristics of the Microplate Method of Enzyme-Linked Immunosorbent Assay for the Detection of Plant Viruses. J. Gen.Virol. 34: 475-483.

Credi, R., Babini, A. R., Betti, L., Bertaccini, A., and Gelli, C. (1981). A distinctive isolate of Strawberry latent ring spot virus from grapevines in Italy. Phytopathol. Mediterr. 20:56-63.

Digiaro, M., Elbeaino, T., and Martelli, G. P. (2007). Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C. J. Virol. Methods, 141(1), 34-40.

Dullemans, A.M., Botermans, M., de Kock, M.J.D., de Krom, C.E., van der Lee, T.A.J., Roenhorst, J.W., Stulemeijer, I.J.E., Verbeek, M., Westenberg, M. and van der Vlugt, R.A.A. (2020). Creation of a new genus in the family Secoviridae substantiated by sequence variation of newly identified Strawberry latent ring spot virus isolates. Arch. Virol., 165(1), pp.21-31.

El-Morsy, S. I., El-Sheikh, M. A., Abd El-Razik, R. A., Youssef, S. A., and Shalaby, A. A. (2017). Molecular Identification of Strawberry Latent Ring Spot Virus (SLRSV) In Egypt. J. Basic and Environ. Sciences, 4, 24-33.

Everett, K. R., Milne, K. S., and Forster, R. L. S. (1994). A new host record: Strawberry latent ring spot virus isolated from flowering cherry. Australas. Plant Pathol. 23:11-15.

Fadel C., Digiaro M., Choueiri E., El Beaino T., Saponari M., Savino V., Martelli G. P. (2005). On the presence and distribution of olive viruses in Lebanon. Bulletin OEPP/EPPO Bulletin 35: 33-36.

Faggioli F., Ferretti L., Pasquini G. and Barba M. (2002). Detection of Strawberry latent ring spot virus in leaves of olive trees in Italy using a one-step RT-PCR. J. Phytopathol., 150: 636–639.

Faggioli, F., Ferretti, L., Albanese, G., Sciarroni, R., Pasquini, G., Lumia, V., and Barba, M. (2005). Distribution of olive tree viruses in Italy as revealed by one-step RT-PCR. J. Plant Pathol., 49-55.

FAO, Food and Agriculture Organization of the United Nations, (2019). Strawberry Production in Egypt. Available Online at http://www.fao.org/faostat/en/#data/QC.

Fry, P. R., and Wood, G. A. (1973). Further viruses of Prunus in New Zealand. N.Z. J. Agric. Res. 16:131-142.

Godena, S., Faggioli, F., Luigi, M., Saponari, M., Loconsole, G., Vončina, D., & Đermić, E. (2016). Incidence of viruses on autochthonous and introduced olive varieties in Croatian Istria detected by three diagnostic techniques. J. Plant Pathol., 657-660.

Haj Ali, M. A. (2020). Biological, Molecular characterization and control of Spiroplasma citri the causal of citrus stubborn disease on Lime trees in Egypt. PhD. Thesis at Department of Plant Pathology, Faculty of Agriculture, Cairo University. 122 P.

Karanis, P., and Ongerth, J. (2009). LAMP–a powerful and flexible tool for monitoring microbial pathogens. Update, 25(11), 498-499.

Kim, J., Lee, S., Choi, J., Kim, S. K., and Jang, W. (2016). Development of Simple and Rapid Diagonosis Method for Strawberry Latent ring spot virus in Plants Using Loop-Mediated Isothermal Amplification Assay. J. Plant Pathol. Microbiol, 7, 377.

Kumar S, Stecher G, Li M, Knyaz C, and Tamura K. (2018). MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 35:1547-1549.

Liu, Y., Wang, Z., Qian, Y., Mu, J., Shen, L., Wang, F., and Yang, J. (2010). Rapid detection of tobacco mosaic virus using the reverse transcription loop-mediated isothermal amplification method. Arch. Virol., 155(10), 1681-1685.

Mayo, M. A., and Jones, A. T. (1999). Nepoviruses (Comoviridae).1007-1013.

Martin, R. R., Tzanetakis, I. E., Barnes, J. E., and Elmhirst, J. F. (2004). First report of Strawberry latent ring spot virus in strawberry in the United States and Canada. Plant Dis., 88(5), 575 – 575.

Martin, R. R., and Tzanetakis, I. E. (2006). Characterization and recent advances in detection of strawberry viruses. Plant Dis., 90(4), 384-396.

Mayo, M. A., Barker, H. and Harrison, B. D. (1982). Specificity and properties of the genome-linked proteins of nepoviruses. J. Gen.Virol. 59, 149-162.

Mazyad, A. A., Kheder, A. A., El-Attar, A., and Amal, A. F. (2014). Characterization of Strawberry Latent Ring spot Virus (SLRSV) on strawberry in Egypt. Egyptian J. Virol, 11(2), 219-235.

Mori, Y. and Notomi, T. (2009). Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious diseases. J. Infect. Chemother. 15, 62–69.

Moury, B., Cardin, L., Onesto, J.P., Candresse, T., Poupet, A. (2000). Enzyme-linked immunosorbent assay testing of shoots grown in vitro and the use of immunocapture-reverse transcription polymerase chain reaction improve the detection of Prunus necrotic ring spot virus in rose. Phytopathology 90, 522–528.

Murant, A. F. (1974). Strawberry latent ring spot virus. No. 126 in: Description of Plant Viruses, CMI/AAB, Surrey, UK.

Murant, A. F. (1981). Nepoviruses, in Handbook of Plant Virus Infections and Comparative Diagnosis (Kurstak, E., ed.), Elsevier/North Holland, Amsterdam, pp. 197–238.

Parida M, Sannarangaiah S, Dash PK, Rao PV and Morita K. (2008). Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev Med Virol 18: 407-421.

Pisi, A. (1986). Strawberry virus diseases 1. EPPO Bulletin, 16(2), 353-358.

Postman D, Tzanetakis IE and Martin RR. (2004). First report of Strawberry latent ring spot virus in a Mentha sp. from North America. Plant Dis 88:907.

Przewodowska, A., Zacharzewska, B., Chołuj, J., and Treder, K. (2015). A one-step, real-time reverse transcription loop mediated isothermal amplification assay to detect potato virus Y. American Journal of Potato Research, 92(3), 303-311.

R. Lister, (1964). Strawberry latent ring spot virus: a new nematode-borne virus. Ann. Appl. Biol. 54, 167-176.

Richmond, J. E., Cowley, J. M., Day, A., Hurrell, J. C., Page, G. D., Herrera, V. E., and Smales, T. E. (1998). Pest and disease survey of stone fruit crops in New Zealand (1997/98) Report for MAFRA. Ministry of Agriculture and Forestry Auckland, New Zealand.

Saponari M., Alkowni R., Grieco F., Pantaleo V., Savino V., Martelli G.P., Driouech N., Hassan M., Di Terlizzi B., Digiaro M., 2002. Detection of Olive-Infecting Viruses in the Mediterranean Basin. In: Vitagliano C., Martelli G.P. (eds). Proceedings of the IV International Symposium on Olive Growing, Acta Hort. (ISHS) 586, pp 787-790.

Schmelzer, K. (1969). Das Latente Erdbeerringflecken‐Virus aus Evonymus, Robinia und Aesculus. J. Phytopathol, 66(1), 1-24.

Sidoti F, Bergallo M, Costa C, Cavallo R. (2013). Alternative molecular tests for virological diagnosis. Mol Biotechnol 53: 352-362.

Soliman, H., and El-Matbouli, M. (2006). Reverse transcription loop-mediated isothermal amplification (RT-LAMP) for rapid detection of viral hemorrhagic septicaemia virus (VHS). Vet. microbiol., 114(3-4), 205-213.

Sriworarat, C., Phumee, A., Mungthin, M., Leelayoova, S., and Siriyasatien, P. (2015). Development of loop-mediated isothermal amplification (LAMP) for simple detection of Leishmania infection. Parasites & Vectors, 8(1), 591.

Tang, J., Ward, L. I., and Clover, G. R. (2013). The diversity of Strawberry latent ring spot virus in New Zealand. Plant Dis, 97(5), 662-667.

Thai, H. T. C., Le, M. Q., Vuong, C. D., Parida, M., Minekawa, H., Notomi, T and Morita, K. (2004). Development and evaluation of a novel loop-mediated isothermal amplification method for rapid detection of severe acute respiratory syndrome coronavirus. Journal of Clinical microbiology, 42(5), 1956-1961.

Thompson JD, Higgins DG, Gibson TJ. (1994). Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position- specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680.

Tomlinson, J. A., Ostoja-Starzewska, S., Adams, I. P., Miano, D. W., Abidrabo, P., Kinyua, Z., and Smith, J. (2013). Loop-mediated isothermal amplification for rapid detection of the causal agents of cassava brown streak disease. J. Virol. Methods, 191(2), 148-154.

Tzanetakis, I. E., Postman, J. D., Gergerich, R. C., and Martin, R. R. (2006). A virus between families: nucleotide sequence and evolution of Strawberry latent ring spot virus. Virus Res. 121:199-204.

Wei, T., and Clover, G. (2008). Use of primers with 5′ non-complementary sequences in RT-PCR for the detection of nepovirus subgroups A and B. J. Virol. Methods, 153(1), 16-21.

Welsh, Martin. (2008).”Strawberries”. Nvsuk.org.uk. Archived from the original on 2 August 2008

Zong, X., Wang, W., Wei, H., Wang, J., Chen, X., Xu, L. and Liu, Q. (2014). Rapid detection of Prunus necrotic ring spot virus using magnetic nanoparticle-assisted reverse transcription loop-mediated isothermal amplification. J. Virol. Methods, 208, 85-89.