Prevalence of Extended Spectrum β-lactamase SHV and OXA Producing Gram Negative Bacteria at Tertiary Care Hospital of Lahore, Pakistan

Abdul Waheed1,2, Sidrah Saleem1, Naveed Shahzad3, Junaid Akhtar4, Muhammad Saeed5, Iqra Jameel1, Farhan Rasheed6 and Shah Jahan7,*

1Department of Microbiology, University of Health Sciences, Lahore, Pakistan

2College of Allied Health Professional, Directorate of Medical Sciences, Government College University, Faisalabad, Pakistan

3School of Biological Sciences, University of the Punjab, Lahore, Pakistan.

4Department of Allied Health Sciences, Sargodha Medical College, University of Sargodha, Sargodha, Pakistan

5Pathology Department, DHQ Hospital, Mandi Bahauddin, Pakistan

6Department of Microbiology, Allama Iqbal Medical College, Lahore, Pakistan 7Department of Immunology, University of Health Sciences, Lahore, Pakistan.

ABSTRACT

The present study was planned to detect drug resistant genes like “blaSHV” and “blaOXA” among gram negative rods (GNRs) isolated from different clinical specimens, collected from Jinnah Hospital Lahore during January-December 2015. Majority of the GNRs were isolated from urine samples (55%) followed by pus (28%), blood (7%), sputum (6%), Broncho-alveolar lavage (2%), fluid (1%) and from tips (1%). The isolated organisms were Escherichia coli (n=60), Klebsiella pneumoniae (n= 20), Enterobacter cloaca (n= 09), Enterobacter aerogenes (n= 02), Proteus mirabilis (n= 05), Proteus vulgaris (n=02) and Citrobacter freundii (n= 02). Extended spectrum beta lactamases (ESBL) production was screened by double disc synergy test (DDST) and combination disc method as per Clinical Laboratory Standard Institute (CLSI) guidelines 2015. Presence of “blaSHV” and “blaOXA” genes was tested by PCR technique. Every isolate was ESBL positive and resistant against third generation cephalosporin and Aztreonam. Notably, 15% of ESBL producing strains harbored blaSHV gene while 43% were positive for blaOXA gene. In a nutshell, diverse variety of ESBL-positive GNRs is distributed, the findings of the present study should be considered for planning strategies to treat and prevent the further spread of ESBL-producing gram-negative rods infections.

Article Information

Received 11 February 2019

Revised 22 May 2019

Accepted 02 August 2019

Available online 19 September 2019

Authors’ Contribution

AW performed the experiments. MS and AW wrote the manuscript. SJ and SS designed the study. JA contributed in data analysing. IJ and FR helped in sample collection. NS reviewed the manuscript.

Key words

Gram negative rods, Extended spectrum β-lactamase, Cephalosporin, blaSHV, blaOXA

DOI: http://dx.doi.org/10.17582/journal.pjz/2019.51.6.2345.2351

* Corresponding author: shahjahan@uhs.edu.pk

0030-9923/2019/0006-2345$ 9.00/0

Copyright 2019 Zoological Society of Pakistan

Introduction

Emergence of drug resistant pathogens is precarious global issue in current medicine. Improper use of antimicrobials induces a selective pressure on microorganisms, which results in the development of antimicrobial resistance (Akhtar et al., 2018). Bacteria use variety of strategies to acquire drug resistance which include enzymes production, extended spectrum beta lactamases (ESBL), metallo beta lactamases (MBL) and Carbapenamases, reduced uptake of drug, efflux of antibiotics and cell target modifications (Fluit et al., 2001).The Gram negative rods (GNRs) are most common source of infection in developing countries. High mortality and morbidity has been associated with GNRs associated infections. A very high death rate 42% to 100% has been reported in patients infected with ESBL producing bacteria (Ehlers et al., 2009; Kaftandzieva et al., 2011; Zaniani et al., 2012; Colodner, 2005). Drug resistance leads to prolonged hospital stay of patients and increase in health expenditures which ultimately effect the economy of country as well as rate of morbidity and mortality (Maragakis et al., 2008). ESBL enzymes production is most potent mechanism, which inactivate beta-lactam antibiotics by destroying the amide bond of beta-lactam ring (Gelinski et al., 2014).

ESBL enzymes producing organisms have been isolated from various clinical samples all over the world. In Pakistan, Ali et al. (2016) reported that ESBL were found in 59.2% of 250 isolates of E. coli. Another study done by Rahman et al. (2016) reported that 44.2% of 355 isolates were ESBL producer. Recently, resistance against carbapenems has also been reported all over the world. This is mainly attributed to special type of beta lactamases called metallo beta lactamases (MBL). These types of enzymes possess capability to break down the carbapenems (Akhtar et al., 2018).

ESBL producing bacteria have usually large plasmids and carry drug resistance genes against various antimicrobial agents. ESBL were first identified in Klebsiella in 1980 (Bush and Jacoby, 2010). Later on it was also reported in various Gram negative rods of Enterobacteriaceae (Abrar et al., 2018). ESBL producing bacteria are difficult to treat with routine antibiotics and they may cause serious infections in surgical and intensive care unit patients. They frequently cause pneumonia, meningitis, peritonitis, intra-abdominal abscess and urinary tract infections (Dhillon et al., 2012). The frequency of ESBL production varies among various GNRs. In Pakistan, high prevalence of ESBL particularly in Escherichia coli, Pseudomonas aeruginosa and Klebsiella pneumoniae has been reported (Sana et al., 2011). More than 1300 clinically significant β lactamases have been isolated up to date. There are four major types of ESBLs which include blaTEM, blaCTX-M, blaSHV, and blaOXA. More than 172 blaTEM, 400 blaOXA, 193 blaSHV and 130 blaCTX-M have been discovered (Lahey Clinic Foundation, 2011; Bush and Jacoby, 2010).

SHV-type beta lactamases derive their name from sulfhydryl variable (Paterson and Bonomo, 2005). According to classification SHV-1 belongs to group A (Chaves et al., 2001). SHV type β lactamases are one of most important types of ESBL found in clinical isolates (Paterson and Bonomo, 2005). They can hydrolyze ceftazidime and cefotaxime efficiently (Bradford, 2001).

OXA type β lactamases are classified in to group D according to functional classification (Poirel et al., 2010). More than 400 variants of OXA type β lactamases have been discovered up to date (Antunes and Fisher, 2014). Wild type OXA-1was involved in hydrolysis of Oxacillin and Cloxacillin that is why they were named OXA (Oxacillin hydrolyzing) (Héritier et al., 2005). These enzymes are very diverse and are capable of posing drug resistance of various spectrums. They can be narrow spectrum or broad spectrum. In Pakistan very, little data is available on identification of extended spectrum β lactamase producing genes. Therefore, present study was planned to detect drug resistant genes like “blaSHV” and “blaOXA” among Gram negative rods isolated from different clinical specimens.

 

MATERIALS AND METHODS

Collection of bacterial isolates

Clinical samples comprising of pus, urine, blood, sputum, broncho-alveolar lavage (BAL) and tips from various patients hospitalized at Jinnah Hospital Lahore during the period of January to December 2015, were cultured for the isolation of gram-negative bacterial strains.

Identification of bacterial isolates

The bacterial isolates were identified by conventional morphology and biochemical based tests. Bacterial strains were sub-cultured on blood and MacConkey agar and plates were incubated at 37°C overnight aerobically (Akhtar et al., 2018). The colony morphology and culture characteristics were studied to identify bacterial species (Akhtar et al., 2018). The isolates were further confirmed employing Analytical Profile Index 20 (API 20 system) (Bio Merieux, France).

Antimicrobial susceptibility determination

Antimicrobial resistance of the study isolates against cephalosporin antibiotics (ceftazidime, ceftriaxone, cefotaxime and aztreonam) was performed by Kirby-Bauer disc diffusion method according to Clinical Laboratory Standards Institute (CLSI) 2015 guidelines. For this, bacterial strains were grown on Mueller-Hinton agar (Oxoid UK) and zone of inhibition was measured around the ceftazidime (30µg), cefotaxime (30µg), ceftriaxone (30µg) and aztreonam (30µg) antibiotic disk. The isolates were classified into susceptible, intermediate or resistant according to the CLSI guidelines. E. coli (ATCC 25922) and K. pneumoniae (ATCC 700603) were used as control strains.

Phenotypic detection of ESBL

Double disc synergy test (DDST)

Clavulanic acid, present in the co-amoxiclav disc, acts synergistically with the third-generation cephalosporin and/or aztreonam and resulted in the increase of zone size of these antimicrobials or elliptical zone between the tested antibiotic disc and co-amoxiclav disc. This was considered as a positive result for ESBL production.

Combination disc method

This method is referred to phenotypic confirmatory method by CLSI guidelines. ESBL detection was done by combined disc method using cefotaxime (30ug) versus cefotaxime plus clavulanate (30+10 μg) and ceftazidime (30μg) versus ceftazidime plus clavulanate (30+10 μg) (Oxoid) according CLSI 2015 guidelines. Isolates which showed an enlarged zone of inhibition greater than 5 mm on the side using combined disc compared to the results seen on the side without clavulanic acid combination were confirmed as ESBL producer.

Molecular identification of ESBL genes

The genomic DNAs were extracted from all phenotypically ESBL producing strains by using TIANamp Genomic DNA extraction (TIANGEN Biotech Beijing, Co., Ltd.). For blaSHV and blaOXA detection, the extracted DNAs were subjected to PCR using primer sequences already described in the literature (Sana et al., 2011). Briefly, forward (5’CACTCAAGGATGTATTGT G-3’) and reverse (5’-TTAGCGTTGCCAGTGCTCG-3’) primers were used for blaSHV detection. Whereas, blaOXA was detected by using forward (5’ACACAATACATATCAACTTCGC3’) and reverse (5’AGTGTGTTTAGAATGGTGATC3’) primers. The PCR conditions were used as follows; initial denaturation at 95°C for 5 min followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 40sec, primary extension at 72°C for 1 min and final extension at 72°C for 10 min. The amplified PCR products were separated on 1.5% agarose gel by gel electrophoresis and visualized under UV light for the evaluation of molecular size of amplified products.

Statistical analysis

Results were analyzed with the SPSS (version 20.0, SPSS Inc). The detection of blaSHV and blaOXA genes in isolates was presented as percentages in the Tables.

 

RESULTS

In the present study, altogether 100 gram-negative rods: E. coli (n=60), Klebsiella pneumoniae (n= 20), Enterobacter cloaca (n= 09), Enterobacter aerogenes (n= 02), Proteus mirabilis (n= 05), Proteus vulgaris (n=02) and Citrobacter freundii (n= 02), were isolated from clinical samples. It is worth mentioning here that majority of the clinical isolates (55%) were recovered from urine followed by 28% from pus, 7% from blood, 6% from sputum, 2% from broncho-alveolar lavage (BAL), 1% from fluid and 1% from tips. The distribution of bacterial isolates in clinical specimens is enlisted in Table I. All of these isolates manifested resistance against third generation cephalosporin and aztreonam antibiotics.

The combination disc method and double disc synergy test for the phenotypic detection of ESBL production revealed that all isolate was positive for ESBL production. The representative ESBL producing isolates by Combination disc method and Double disc synergy test are shown in Figure 1.

 

The ESBL producing isolates were further subjected to PCR for the detection of blaSHV and blaOXA genes the presence of which is considered as one of foremost mechanism of cephalosporin resistance among gram-negative rods. The blaSHV positive samples showed amplification products of 885 bp as shown in Supplementary Figure 1A. Similarly, the amplification of 813 bp PCR product from carbapenem resistant isolates indicated that those isolates harbor blaOXA gene. A representative gel showing the PCR product of blaOXA gene is presented in Supplementary Figure 1B. In the nutshell, PCR data showed that only 15 (15%) of ESBL producing strains harbor blaSHV gene. Among those blaSHV positive isolates, twelve strains were of K. pneumoniae and three of E. coli. However, none of E. cloaca, E. aerogenes, P. mirabilis, P. vulgaris and C. freundii strain was found harboring blaSHV gene. Unlike blaSHV, elevated blaOXA gene positivity 43 (43%) was observed among ESBL producing clinical isolates. Among those 43 blaOXA positive isolates, 30 (30%) strains were of E. coli, 8 (08%) of K. pneumoniae, 3 (3%) of E. cloaca and 2 (2%) of P. mirabilis. The Table II briefly describes the distribution of blaSHV and blaOXA genes in ESBL producing gram negative rods under this study.

 

DISCUSSION

The most dominant ESBL producer in present study was E. coli (n=60) followed by K. pneumoniae (n= 20). A study was conducted by Khalid et al. (2013) in Pakistan reported E. coli as leading ESBL producer followed by K. pneumoniae. These results are similar to our study results.

 

Table I. Distribution of bacterial isolates in clinical specimens.

Organism	Sources of sample
	Urine	Pus	Blood	Sputum	BAL	Fluid	TIP
Escherichia coli	34 (56.6%)	19 (31.6%)	05 (8.3%)	0	0	01 (1.6%)	01 (1.6%)	n=60
Klebsiella pneumoniae	07 (35%)	04 (20%)	01 (5%)	6 (30%)	2 (10%)	0	0	N=20
Enterobacter cloacae	07 (77.7%)	01 (11%)	1 (11%)	0	0	0	0	N=9
Enterobacter aerogenes	01 (50%)	01 (50%)	0	0	0	0	0	N=2
Proteus mirabilis	04 (80%)	01 (20%)	0	0	0	0	0	N=5
Proteus vulgaris	01 (50%)	01 (50%)	0	0	0	0	0	N=2
Citrobacter freundii	01 (50%)	01 (50%)	0	0	0	0	0	N=2
Total.	55 (55 %)	28 (28 %)	07 (7 %)	06 (6%)	2 (2%)	01 (01%)	01 (01%)	100

 

Table II. Distribution of blaSHV and blaOXA in ESBL producing gram-negative rods.

Organism	blaSHV (N=15)	blaOXA (N=43)
Escherichia coli (n=60)	03 (5%)	30 (50%)
Klebsiella pneumoniae (n=20)	12 (60%)	08 (40%)
Enterobacter cloaca (n=09)	0 (0%)	03 (33.3%)
Enterobacter aerogenes (n=02)	0 (0%)	0 (0%)
Proteus mirabilis (n=05)	0 (0%)	02 (40%)
Proteus vulgaris (n= 02)	0 (0%)	0(0%)
Citrobacter freundii (n= 02)	0(0%)	0(0%)
Total:100	15%	43%

 

Urinary tract infections are severe health affecting problems all over the world. The most common organism associated with urinary tract infections are E. coli, K. pneumoniae, and P. mirabilis. The E. coli is responsible for nearly 85% of community acquired urinary tract infections and approximately 50% of hospital acquired urinary tract infections. The E. coli is also one of most common organisms which are isolated from catheter associated urinary tract infections (Sabir et al., 2014).

The overall prevalence of blaSHV and blaOXA in present study was 15% and 43% respectively. Similarly, a study was conducted by Moosavian et al. (2012) on various members of ESBL producing enterobacteriaceae reported 15 % of blaSHV gene prevalence. Another similar study was carried out by Zaniani et al. (2012) in Iran who reported 14.4% blaSHV prevalence among ESBL producing K. pneumoniae and E. coli. Another study, carried out by Ramazanzadeh et al. (2010) in Iran showed 18.7% blaSHV prevalence in ESBL producing K. pneumoniae. The findings of this study are in accordance with our study results. A very little data is available on ESBL genes in Pakistan. Hussain et al. (2011) conducted a study in Islamabad, Pakistan and they reported 15.4% blaSHV gene. Zongo et al. (2015) reported 18.7% blaSHV prevalence in West Africa. Yesmin et al. (2015) reported 18.69% of blaSHV prevalence from Bangladesh in various members of Enterobactericeae and Pseudomonas species. These results are in accordance to the results of current study.

In current study the blaSHV was most commonly found in K. pneumoniae. About 12 (60%) from 20 isolates were positive for blaSHV gene. A study was conducted by Ahmed et al (2013) revealed 63.1% blaSHV gene positive among ESBL producing K. pneumoniae. Similar study conducted by Shahcheraghi et al. (2007) in Iran and described 69% prevalence of blaSHV in K. pneumoniae. In another study Feizabadi et al. (2010) so reported similar high prevalence of blaSHV (67.4%) in K. pneumoniae.

In our study blaOXA gene was detected in 43% of isolates. A study was carried out by Farzana et al. (2013) in Dhaka, Bangladesh and reported 43% blaOXA gene in ESBL producing GNRs isolated from pus and wound samples. Sana et al. (2011) conducted a study in Lebanon and they reported 45.2% isolates were positive for blaOXA gene. Another study was conducted by Moubareck et al. (2005) in Lebanon they reported alike results for blaOXA gene in extended spectrum β lactamase producing enterobacteriaceae.

Mostatabi et al. (2013) showed 20.51% prevalence of blaOXA gene from clinical isolates of Serratia. In Pakistan, few studies were done to identify ESBL producing genes. A study was done in Faisalabad, Pakistan and prevalence of blaOXA gene was found to be 17.2% in ESBL producing E. coli (Saeed et al., 2009). These results are different from the current study. The geographical variations could explain this disparity in results. Moreover, discrepancy in results may also be due to different sample sizes and difference in time which the bacterial isolates were collected (Al-Agamy et al., 2009).

There are few limitations in our study. The sample size was not large enough to describe the exact burden of beta lactamases genes in our region. Because, history of the patient was not collected so we were unable to discriminate between nosocomial and community acquired strains of pathogens.

Appropriate infection­ control practices and barriers are crucial to avoid spread and outbreaks of ESBL producing gram negative rods. Furthermore, policy of antibiotic rotation should be adopted to stop the further spread and selection of extended spectrum β lactamases producing bacteria. The other genes that are associated extended spectrum β lactamases production should be explored to find out the genes that are more common in Pakistan.

CONCLUSION

The blaSHV and blaOXA genes are also present in our population. blaOXA is more prevalent in ESBL producing gram negative rods in locality of Lahore, Pakistan. In this study we concluded that blaOXA is more dominant type of ESBL in E. coli than other gram negative rods in our area. While blaSHV is principal type of ESBL in Klebsiella pneumoniae. In this study it was also concluded that most of the ESBL producing organism were isolated from urine and pus.

 

ACKNOWLEDGMENT

We are thankful to University of Health Sciences, Lahore and School of Biological Sciences, Lahore for providing opportunity to conduct practical work of this project. We also thankful to the tertiary care hospital that provided the clinical samples for this study. We are thankful to University of Health Sciences, Lahore for providing logistics and funding for this project.

 

Supplementary material

There is supplementary material associated with this article. Access the material online at: http://dx.doi.org/10.17582/journal.pjz/2019.51.6.2345.2351

 

Statement of conflict of interests

The authors declare there is no conflict of interest.

 

REFeRENCES

Abrar, S., Hussain, S., Khan, R.A., Ain, N.U., Haider, H. and Riaz, S., 2018. Prevalence of extended-spectrum-β-lactamase-producing Enterobacteriaceae: first systematic meta-analysis report from Pakistan. Antimicrob. Resist. Infect. Control, 7: 1-11. https://doi.org/10.1186/s13756-018-0309-1

Ahmed, O.I., El-Hady, S.A., Ahmed, T.M. and Ahmed, I.Z., 2013. Detection of bla SHV and bla CTX-M genes in ESBL producing Klebsiella pneumoniae isolated from Egyptian patients with suspected nosocomial infections. Egyptian J. med. Hum. Genet. 14: 277-283. https://doi.org/10.1016/j.ejmhg.2013.05.002

Akhtar, J., Saleem, S., Shahzad, N., Waheed, A., Jameel, I., Rasheed, F. and Jahan, S., 2018. Prevalence of metallo-β-lactamase IMP and VIM producing Gram negative bacteria in different hospitals of Lahore, Pakistan. Pakistan J. Zool., 50: 2343-2349. https://doi.org/10.17582/journal.pjz/2018.50.6.2343.2349

Al-Agamy, M.H., Shibl, A.M. and Tawfik, A.F., 2009. Prevalence and molecular characterization of extended-spectrum β-lactamase-producing Klebsiella pneumoniae in Riyadh, Saudi Arabia. Anals Saudi Med., 29: 253-260. https://doi.org/10.4103/0256-4947.55306

Ali, I., Rafaque, Z., Ahmed, S., Malik, S. and Dasti, J.I., 2016. Prevalence of multidrug-resistant uropathogenic Escherichia coli in Potohar region of Pakistan. Asian Pac. J. trop. Biomed. 6: 60–66. https://doi.org/10.1016/j.apjtb.2015.09.022

Antunes, N.T. and Fisher, J.F., 2014. Acquired class D β-lactamases. Antibiotics, 3: 398-434. https://doi.org/10.3390/antibiotics3030398

Bradford, P.A., 2001. Extended-spectrum β-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev., 14: 933-951. https://doi.org/10.1128/CMR.14.4.933-951.2001

Bush, K. and Jacoby, G.A., 2010. Updated functional classification of β-lactamases. Antimicrob. Agents Chemother., 54: 969-976. https://doi.org/10.1128/AAC.01009-09

Carlet, J., Jarlier, V., Harbarth, S., Voss, A., Goossens, H. and Pittet, D., 2012. Ready for a world without antibiotics? The pensières antibiotic resistance call to action. Antimicrob. Resist. Infect. Contr., 1: 1-13.https://doi.org/10.1186/2047-2994-1-11

Chaudhary, U. and Aggarwal, R., 2004. Extended spectrum-lactamases (ESBL)-An emerging threat to clinical therapeutics. Indian J. med. Microbiol., 22: 75-80.

Chaves, J., Ladona, M.G., Segura, C., Coira, A., Reig, R. and Ampurdanés, C., 2001. SHV-1 β-lactamase is mainly a chromosomally encoded species-specific enzyme in Klebsiella pneumoniae. Antimicrob. Agents Chemother., 45: 2856-2861. https://doi.org/10.1128/AAC.45.10.2856-2861.2001

Clinic, L., 2015. ß-lactamase classification and amino acid sequences for TEM, SHV and OXA extended-spectrum and inhibitor resistant enzymes. Lahey Clinic Foundation Burlingto [Online]. Available at: http://www.lahey.org/studies/other.asp#table1.html [Accessed 24 May 2015]

Colodner, R., 2005. Extended-spectrum β-lactamases: a challenge for clinical microbiologists and infection control specialists. Am. J. Infect. Contr., 33: 104-107. https://doi.org/10.1016/j.ajic.2004.07.010

Dhillon, R.H.P. and Clark, J., 2012. ESBLs: a clear and present danger? Crit. Care Res. Pract., 2012:1-11. https://doi.org/10.1155/2012/625170

Ehlers, M.M., Veldsman, C., Makgotlho, E.P., Dove, M.G., Hoosen, A.A. and Kock, M.M., 2009. Detection of blaSHV, blaTEM and blaCTX-M antibiotic resistance genes in randomly selected bacterial pathogens from the Steve Biko Academic Hospital. FEMS Immun. med. Microbiol., 56: 191-196. https://doi.org/10.1111/j.1574-695X.2009.00564.x

Farzana, R., Shamsuzzaman, S., Mamun, K. and Shears, P., 2013. Antimicrobial susceptibility pattern of extended spectrum (beta-lactamase producing gram-negative bacteria isolated from wound and urine in a tertiary care hospital, Dhaka city, Bangladesh. Southeast Asian J. Trop. Med. Publ. Hlth., 44: 96-103.

Feizabadi, M.M., Delfani, S., Raji, N., Majnooni, A., Aligholi, M., Shahcheraghi, F., Parvin, M. and Yadegarinia, D., 2010. Distribution of bla TEM, bla SHV, bla CTX-M genes among clinical isolates of Klebsiella pneumoniae at Labbafinejad Hospital, Tehran, Iran. Microb. Drug. Resist., 16: 49-53. https://doi.org/10.1089/mdr.2009.0096

Fluit, A., Schmitz, F., Verhoef, J. and Participants, E.S., 2001. Multi-resistance to antimicrobial agents for the ten most frequently isolated bacterial pathogens. Int. J. Antimicrob. Agents, 18: 147-160. https://doi.org/10.1016/S0924-8579(01)00357-0

Gelinski, J.M.L.N., Bombassaro, A., Baratto, C.M. and Vicente, V.A., 2014. Resistance to extended-spectrum β-lactamases in Salmonella from a broiler supply chain. Int. J. environ. Res. Publ. Hlth., 11: 11718-11726. https://doi.org/10.3390/ijerph111111718

Héritier, C., Poirel, L., Fournier, P.E., Claverie, J.M., Raoult, D. and Nordmann, P., 2005. Characterization of the naturally occurring oxacillinase of Acinetobacter baumannii. Antimicrob. Agents Chemother., 49: 4174-4179. https://doi.org/10.1128/AAC.49.10.4174-4179.2005

Hussain, M., Hasan, F., Shah, A.A., Hameed, A., Jung, M., Rayamajhi, N., Cha, S.-B. and Yoo, H.S., 2011. Prevalence of class A and AmpC b-lactamases in clinical Escherichia coli isolates from Pakistan Institute of Medical Science, Islamabad, Pakistan. Jpn. J. Infect. Dis., 64: 249-252.

Kaftandzieva, A., Trajkovska-Dokic, E. and Panovski, N., 2011. Prevalence and molecular characterization of extended spectrum beta-lactamases (ESBLs) producing Escherichia coli and Klebsiella pneumoniae. Prilozi, 32: 129-41.

Kapil, A., 2005. The challenge of antibiotic resistance: need to contemplate. Indian J. med. Res., 121: 83-91.

Khalid, A., Usman, J., Kaleem, F., Hassan, A., Omair, M. and Anjum, R., 2013. The frequency and antimicrobial sensitivity pattern of extended spectrum-lactamase (ESBLs) producing gram negative bacilli isolated from urine in a tertiary care hospital of Pakistan. Afr. J. Microbiol. Res., 7: 2040–2043. https://doi.org/10.5897/AJMR12.996

Lahey Clinic Foundation 2011. ß-Lactamase classification and amino acid sequences for TEM, SHV and OXA extended-spectrum and inhibitor resistant enzymes. Available at: http://www.lahey.org/Studies [Date accessed 27-05-2015].

Maragakis, L.L., Perencevich, E.N. and Cosgrove, S.E., 2008. Clinical and economic burden of antimicrobial resistance. Expert Rev. Anti-infect. Ther., 6: 751-763. https://doi.org/10.1586/14787210.6.5.751

Moosavian, M. and Deiham, B., 2012. Distribution of TEM, SHV and CTX-M Genes among ESBL-producing enterobacteriaceae isolates in Iran. Afr. J. Microbiol. Res., 6: 5433-5439. https://doi.org/10.5897/AJMR11.017

Mostatabi, N., Farshad, S. andRanjbar, R., 2013. Molecular evaluations of extended spectrum β-lactamase producing strains of Serratia isolated from blood samples of the patients in Namazi Hospital, Shiraz, Southern Iran. Iranian J. Microbiol., 5: 328.

Moubareck, C., Daoud, Z., Hakimé, N.I., Hamzé, M., Mangeney, N., Matta, H., Mokhbat, J.E., Rohban, R., Sarkis, D.K. and Doucet-Populaire, F., 2005. Countrywide spread of community-and hospital-acquired extended-spectrum β-lactamase (CTX-M-15)-producing Enterobacteriaceae in Lebanon. J. clin. Microbiol., 43: 3309-3313. https://doi.org/10.1128/JCM.43.7.3309-3313.2005

Paterson, D.L. and Bonomo, R.A., 2005. Extended-spectrum β-lactamases: a clinical update. Clin. Microbiol. Rev., 18: 657-686. https://doi.org/10.1128/CMR.18.4.657-686.2005

Poirel, L., Naas, T. and Nordmann, P., 2010. Diversity, epidemiology and genetics of class D β-lactamases. Antimicrob. Agents Chemother., 54: 24-38. https://doi.org/10.1128/AAC.01512-08

Rahman, H., Naeem, M., Khan, I., Khan, J., Haroon, M., Bari, F., Ullah, R. and Qasim, M., 2016. Molecular prevalence and antibiotics resistance pattern of class a bla CTX-M-1 and bla TEM-1 β- Lactamases in uropathogenic Escherichia coli isolates from Pakistan. Turk. J. med. Sci., 46: 897–902. https://doi.org/10.3906/sag-1502-14

Ramazanzadeh, R., 2010. Prevalence and characterization of extended-spectrum beta-lactamase production in clinical isolates of Klebsiella spp. Afr. J. Microbiol. Res., 4: 1359-1362.

Rezai, M.S., Salehifar, E., Rafiei, A., Langaee, T., Rafati, M., Shafahi, K. and Eslami, G., 2015. Characterization of multidrug resistant extended-spectrum beta-lactamase-producing Escherichia coli among uropathogens of Pediatrics in North of Iran. Biol. Med. Res. Int. 2015.75-81. https://doi.org/10.1155/2015/309478

Sabir, S., Anjum, A.A., Ijaz, T. and Ali, M.A., 2014. Isolation and antibiotic susceptibility of E. coli from urinary tract infections in a tertiary care hospital. Pakistan J. med. Sci., 30: 389-395. https://doi.org/10.12669/pjms.302.4289

Saeed, M.A., Haque, A., Ali, A., Mohsin, M., Bashir, S., Tariq, A., Afzal, A., Iftikhar, T. and Sarwar, Y., 2009. A profile of drug resistance genes and integrons in E. coli causing surgical wound infections in the Faisalabad region of Pakistan. J. Antibiot., 62: 319-323. https://doi.org/10.1038/ja.2009.37

Sana, T., Rami, K., Racha, B., Fouad, D., Marcel, A., Hassan, M., Sani, H. and Monzer, H., 2011. Detection of genes TEM, OXA, SHV and CTX-M in 73 clinical isolates of Escherichia coli producers of extended spectrum Beta lactamases and determination of their susceptibility to antibiotics. Int. Arab. J. Antimicrob. Agents, 1: 1-6.

Sengupta, S., Chattopadhyay, M.K. and Grossart, H.P., 2013. The multifaceted roles of antibiotics and antibiotic resistance in nature. Front. Microbiol., 4: 1-13. https://doi.org/10.3389/fmicb.2013.00047

Shahcheraghi, F., Moezi, H. and Feizabadi, M.M., 2007. Distribution of TEM and SHV beta-lactamase genes among Klebsiella pneumoniae strains isolated from patients in Tehran. Med. Sci. Rev., 13: 247-250.

Shahid, M., Malik, A., Akram, M., Agrawal, L., Khan, A. and Agrawal, M., 2008. Prevalent phenotypes and antibiotic resistance in Escherichia coli and Klebsiella pneumoniae at an Indian tertiary care hospital: plasmid-mediated cefoxitin resistance. Int. J. Infect. Dis., 12: 256-264. https://doi.org/10.1016/j.ijid.2007.08.008

Sharma, J., Sharma, M. and Ray, P., 2010. Detection of TEM and SHV genes in Escherichia coli and Klebsiella pneumoniae isolates in a tertiary care hospital from India. Indian J. med. Res., 132: 332-336.

Yesmin, T., Sayam, M.A.N., Quader, M.M., Khan, A.H. and Yusuf, M.A., 2015. Comparison of two phenotypic double disc diffusion test (DDDT) for detection of extended spectrum β-lactamase production by enterobacteriaceae and Pseudomonas species at a tertiary care hospital in Bangladesh. Immunol. Infect. Dis., 3: 19-23.

Zaniani, F.R., Meshkat, Z., Nasab, M.N., Khaje-Karamadini, M., Ghazvini, K., Rezaee, A., Esmaily, H., Nabavinia, M.S. andHoseini, M.D., 2012. The prevalence of TEM and SHV genes among extended-spectrum beta-lactamases producing Escherichia coli and Klebsiella pneumoniae. Iranian J. Basic med. Sci., 15: 654-660.

Zongo, K., Dabire, A.M., Compaore, L., Sanou, I., Sangare, L., Simpore, J. and Zeba, B., 2015. First detection of bla TEM, SHV and CTX-M among Gram negative bacilli exhibiting extended spectrum β-lactamase phenotype isolated at University Hospital Center, Yalgado Ouedraogo, Ouagadougou, Burkina Faso. Afr. J. Biotechnol., 14: 1174-1180. https://doi.org/10.5897/AJB2014.13908