Molecular, Serological and Pathological Detection of Mycobacterium avium subsp. paratuberculosis Infection in Small Ruminants in Peshawar, Pakistan

Muhammad Izhar ul Haque1, Farhan Anwar Khan1*, Umar Sadique1, Hamayun Khan1, Zia ur Rehman1, Salman Khan1, Hayatullah Khan1,2, Faisal Ahmad1,3, Mumtazur Rahman1, Faiz Ur Rehman1, Muhammad Saeed1, Mehboob Ali1 and Saqib Nawaz1

1Department of Animal Health, Faculty of Animal Husbandry and Veterinary Sciences, The University of Agriculture, Peshawar, Pakistan

2Directorate of Livestock and Dairy Development (Extension), Peshawar, 25000, Khyber Pakhtunkhwa, Pakistan

3Directorate of Livestock and Dairy Development (Research), Peshawar, 25000, Khyber Pakhtunkhwa, Pakistan

ABSTRACT

Paratuberculosis (pTB) also known as Johne’s disease (JD), is a chronic infectious disease of animals caused by Mycobacterium avium subsp. paratuberculosis (MAP). It is also a serious public health concern as MAP is responsible for Crohn’s disease in human beings. This infectious disease is so far unexplored in animals in Khyber Pakhtunkhwa (KP) province of Pakistan. Therefore, this study was proposed to investigate the presence of MAP by indirect ELISA (iELISA), associated histopathological lesions and PCR in sheep (Ovis aries) and goats (Capra aegagru hircus) in district Peshawar. Serum and fecal samples were collected at random both from commercial farms and abattoirs. Additionally, tissue samples (intestine and mesenteric lymph node (MLN)) were collected at random from sheep and goats at abattoirs of district Peshawar. Analyses of serum samples by iELISA revealed the presence of antibodies against MAP in 9% sheep and 5% goats. Ziehl Nielsen (ZN) staining exhibited acid-fast bacilli (AFB) in 31% sheep and 23% goat’s fecal impression smears. Gross pathology in intestinal samples (thickness, corrugation) was observed in 30% sheep and 22% goats, while MLN exhibited gross lesions (hemorrhages, edematous swelling) in 35% sheep and 27% goats. Histopathological lesions were observed in intestine and MLN in 26% and 19% sheep, and 17% and 14% goats, respectively. Additionally, PCR revealed the presence of MAP in tissue samples of 5% sheep and 3% goat. This study concluded that MAP is present in the small ruminants of district Peshawar. The infection was confirmed by PCR and iELISA. The presence of MAP could be a serious threat to livestock and public health in the region.

Article Information

Received 14 October 2019

Revised 12 January 2020

Accepted 14 February 2020

Available online 01 March 2022

(early access)

Published 02 November 2022

Authors’ Contribution

MIH, FAK and US designed and conceived the study. MIH, SN, MS, FR, FA and HUK carried out the research. MIH, FAK, MA, MR, ZR and SK analyzed the data. MIH, FAK, MS, and FR wrote the manuscript. FAK, US, and HK critically reviewed and revised the manuscript.

Key words

Paratuberculosis, Small ruminants, iELISA, Histopathology, ZN staining, PCR

DOI: https://dx.doi.org/10.17582/journal.pjz/20191014071021

* Corresponding author: farhan82@aup.edu.pk

0030-9923/2023/0001-307 $ 9.00/0

Copyright 2023 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

Paratuberculosis (pTB), also known as Johne’s disease, is specific infectious granulomatous enteritis of cattle, sheep, goats, deer, camelids and wild ruminants (Thorel et al., 1990). Mycobacterium avium subsp. paratuberculosis (MAP), slow growing acid fast bacillus, is a causative agent of pTB or JD (Ayele et al., 2001). It is a contagious disease and can affect both domestic and wild ruminants (Khan et al., 2010). Animals become infected early in life but do not develop clinical sign and symptoms, at the age of 5 months the calves shed MAP in feces. During this subclinical phase of infection, the pathogens can shed in feces and can spread throughout the herd (Hasonova et al., 2009).

Mycobacterium avium subsp. paratuberculosis was first reported in Australia in 1895 and isolated in 1910 (Twort, 1910). Generally, the MAP has three strains i.e. Strain I (sheep strain), Strain II (cattle strain) and Strain III (intermittent strain) (Gwozdz, 2010). The disease is wide spread, become more common and has been reported worldwide (Vansnick, 2004). Anyhow the disease is still not endemic in different parts of the world (Okuni, 2013). Some states of Australia and Sweden have been proved to be free of the disease. Among the small ruminants, prevalence of Johneʼs disease in goats has been reported from all over the world; in France 62.9% (Mercier et al., 2010), in Cyrus 7.9% (Liapi et al., 2011), in Argentina 44.1% (Fiorentio et al., 2012), in Chile 74.3% (Salgado et al., 2007), in USA 76.9% (Manning et al., 2002) and in India 79.4% (Singh et al., 2013). There are many reports of Johneʼs disease in sheep and goats from Pakistan. In Punjab 11.19% of ruminants have been previously reported by Sikandar et al. (2011).

During clinical phase of infection from one herd to other the pathogen can be transmitted through contaminated equipment, water, feces and contaminated food. Semen and accessory reproductive organs are the common route through which the male animals may carry MAP (Hines et al., 2007; Seyyedin et al., 2010). Debility and diarrhea are the main symptoms of pTB in ruminants. The initial symptoms can be subtle and may be limited to roughening of the hair coat, decreased milk production and weight loss. Thick diarrhea mucus and epithelial debris are the symptoms in infected animals. During terminal stage of infection, mild and progressive signs are seen in animals (Beard et al., 2001; Khan et al., 2010). The transmission of MAP to humans may occur through animal contact, meat and raw milk consumption (Eltholth et al., 2009). Therefore, MAP could be cause serious inflammatory bowel disease in humans known as Crohn’s disease. Milk and its products are a potential source of infection to humans (Greig et al., 1999; Khan et al., 2010).

Diagnosis of MAP by culture is a gold standard but is very laborious because of very slow growth of MAP taking 8-16 weeks in vitro. Other test like Johnin could be used in live animals for screening of herd or flock but evidences have accumulated about its lower accuracy (Nielsen, 2008). Beside, diagnosis of pTB can also be achieved through direct detection of the pathogen by conventional ZN staining, and polymerase chain reaction (PCR). Diagnosis of MAP infection could be achieved indirectly using gamma interferon assay, enzyme linked immuno–sorbent assay (ELISA), complement fixation test (CFT) and delayed–type hypersensitivity (DTH). Among all these tests PCR is more sensitive and specific method for the detection of MAP. However in antibiotic treated animals sometime detection of MAP via PCR is rather difficult. Therefore, serological method like ELISA is more reliable method, as it could detect MAP antibodies even in treated animals. Histopathology, postmortem lesions and clinical signs are considered as complementary sources of pTB diagnosis.

We have a dense population of sheep and goats in Pakistan. They are posing high risks for numerous infectious diseases. As pTB is one of the most neglected and unexplored infectious diseases studied so far in KPK Province either in large or small ruminants. This study was undertaken in KPK, Pakistan. We have detected the presence of MAP in small ruminants using molecular and conventional diagnostic tools. The presence of MAP could be a serious threat to livestock and public health in the region.

MATERIALs AND METHODS

Collection of samples

Samples from the small ruminants were randomly collected at the farms and abattoirs of district Peshawar during December 2017 - January 2018. A total of 150 (Sheep n=75, Goats n=75) serum samples from farms and 200 (Sheep n=100, Goats n=100) from abattoirs were collected. A total of 150 (Sheep n=75, Goats n=75) fecal samples from farms and 200 (Sheep n=100, Goats n=100) from abattoirs were collected. Additionally, 100 intestine and 100 MLN tissues from sheep and 100 each from goats were collected at random from abattoirs. Samples for ZN staining, ELISA and PCR were transported at 4°C, while tissue samples for histopathology were transported in 10 % buffered formalin to Histopathology laboratory, Department of Animal Health, The University of Agriculture, Peshawar. Samples were processed directly or stored at -20°C for further analyses.

Serological study

Blood samples (3-4 ml) were collected aseptically from the jugular vein of each animal. Samples were centrifuged at 4000 rpm for 5 min for the separation of sera. The serum samples were subjected to commercially available ID screen paratuberculosis Indirect ELISA Kit (Innovative Diagnostic Lab lillidale, Uk). Samples were analyzed according to manufacturer instructions.

Gross and histopathology

Tissue samples from the animals showing AFB in their impression smears were subjected to histopathology as reported elsewhere (Bancroft and Gamble, 2007). Intestinal samples (ileocecal junction) and mesenteric lymph nodes (MLN) were examined for gross pathology. Gross lesions were recorded in the tissue samples, i.e. hemorrhage, mucosal thickening or corrugations, congestion, and edematous swelling, and scored semi quantitatively (Buergelt et al., 2000; Khan et al., 2010) by severity using a mild (1), moderate (2), and severe (3) scale of assessment. After which suitable segments were incised from these tissue samples for histopathology. Later on these samples were washed overnight in order to remove formalin. Then dehydration, clearing, infiltration, embedding, sectioning and routine H and E staining were carried out on the sections (Bancroft and Gamble, 2007). In the mucosa and upper portions of the submucosa of the intestinal sections following histopathological changes were observed i.e. infiltration of mononuclear cells along with mild infiltration of neutrophils and eosinophils, atrophy of mucosal crypts, presence of epithelioid cells, mucosal exfoliation, fatty change in the sub-mucosa and muscularis layer. In MLN, degeneration of lymphocytes showing pyknosis and karyolysis, necrotic foci, and lymphoid cell depletion, vacuoles and less lymphocytes in the lymphoid follicles were examined.

Ziehl-Neelsen staining

Ziehl-Neelsen staining was performed for recording smear positivity for AFB using fecal impression smears as described previously (Cappuccino and Sherman, 2008). In brief, fecal samples were smeared on glass slide. After air drying, fecal impression smears were heat fixed and subjected to ZN staining. After staining, AFB were examined under microscope (100X).

DNA extraction of MAP from tissue samples

Tissues samples (intestinal, MLN) showing gross and histopathology were processed for DNA extraction of MAP. Commercially available DNA extraction kit from tissue samples (NucleoSpin®, Macherey, Nagel, 2012, Germany) was used for the extraction of DNA.

 

Table I. Set of primers used for PCR analysis of intestinal tissue infected with Mycobacterium avium subsp. paratuberculosis.

Target region	Sequence (5/–3/)	Product size
IS900 of MAP IS900-F IS900-R	GTTATTAACGACGCCCAGC	626 bp
	ACGATGCTGTGTTGGGCGTTA
IS1311 of MAP IS1311-F IS1311-R	TGAACGGAGCGCATCACGAA	550 bp
	TGCAGCTGGTGATCTCTGAT

 

PCR analyses

For the detection of MAP in tissue samples by PCR, two sets of specific primers presented in Table I targeting IS900 and IS1311 of MAP were used as described previously (Khan et al., 2010). In brief, PCR was performed using thermal cycler (Bio-Rad, USA). The PCR was conducted in 25 µl reaction mixture containing 1X polymerase buffer 2.5 µl, 1 µl MgCl2, 0.5 µl dNTPs, 0.5 µl of each primer, 0.4 µl Taq polymerase (Thermo scientific, USA) and 0.5 µl of genomic DNA, and remaining volume was of nuclease free H2O. The amplification was done for 35 cycles at 95ºC for 3 min, 55ºC for 1 min and 72ºC for 5 min. A final extension was done at 72ºC for 10 min. PCR product was run on 1.5% agarose gel in 1X TAE buffer. Product gel was visualized by gel doc system (Fasgene, Germany).

 

Table II. Serological analyses of serum samples collected from small ruminants at Farm/Abattoir by iELISA.

Species	Serum samples collected at farm and abattoir
	Total samples	Positive samples	Negative sample	% Prevalence
Sheep	175	16	159	9.0
Goat	175	9	166	5.0
Total	350	25	325	7.0

 

Statistical analysis

The data collected in the present study were analyzed through descriptive statistics by using SPSS version 20.0 and prevalence was expressed in percentage along with chi square test between the species.

RESULTS

Pathological lesions in tissue samples

Tissue samples including intestinal (ileo-caecal junction) and MLN from both sheep and goats were examined for gross lesions and histopathological lesions. Out of 100 sheep, 40% animals were emaciated, scored on the basis of atrophy of body fat, and 60% were in normal body condition. Diarrhea was noticed in 17.5% emaciated animals. After slaughtering, intestines from animals (30%) and MLN from 35% animals exhibited various different gross pathology, i.e., hemorrhages, mucosal thickening or corrugation, congestion, and edematous swelling (Table III). In a total of 100 goats, emaciation was observed in 30% of animals and 70% goats were in good body condition. Only six emaciated goats were suffering from diarrhea. Intestinal samples from twenty two animals and MLN from 27 animals were showing various gross lesions (Table III).

Histopathological lesions were observed in intestinal and MLN samples from 26 % and 19 % sheep, respectively, whereas 17 % and 14 % goats were showing lesions, respectively, in intestine and MLN.

Presence of acid fast bacilli (AFB) in fecal impression smears

Fecal impression smears were analyzed by ZN staining for the presence of AFB. The percent prevalence of AFB in impression smear from small ruminants

 

Table III. Apparent body condition and gross lesion of various degrees in tissue samples of examined animals.

Animal Species	Body condition/no. of animals(%)	Types of Tissue sample	No. of samples having gross lesion, n (%)	Observed gross lesion in tissue samples, n (%)	Tissue samples having gross lesion of various degrees (%)
					Mild	Moderate	Severe
Sheep (100)	Emaciated/40 (40)	Intestine MLN	30 (30) 35 (35)	Hg and Cr ES and Cg	6(20) 9(25.7)	9(30) 12(34.2)	15(50) 14(40)
	Normal/60 (60)	Intestine MLN	0(0) 0(0)	Hg and Cr ES and Cg	0(0) 0(0)	0(0) 0(0)	0(0) 0(0)
Goat (100)	Emaciated/30 (30)	Intestine MLN	22 (22) 27 (27)	Hg and Cr ES and Cg	4(18.1) 6(22.2)	6(27.2) 10(37.03)	12(54.5) 11(40.7)
	Normal/70 (70)	Intestine MLN	0(0) 0(0)	Hg and Cr ES and Cg	0(0) 0(0)	0(0) 0(0)	0(0) 0(0)

 

Hg and Cr hemorrhage and corrugation observed in the intestinal tissue (terminal ileum) of emaciated and normal sheep and goats, ES and Cg edematous swelling and congestion noticed in the MLN of emaciated and normal sheep and goats.

 

Table IV. Detection of acid fast bacilli (AFB) through ZN-staining in fecal impression smear.

Species	Fecal samples collected at farm and abattoir
	Total samples	Positive samples	Negative samples	% Prevalence
Sheep	175	54	121	31
Goat	175	40	135	23
Total	350	94	256	27

 

collected both at farm and abattoirs is presented in Table IV. The total number of fecal impression smears examined was 350 (Sheep n=175, Goats n=175). Among the total 175 fecal samples from sheep 54 were found positive for AFP, while 40 out 175 samples from goats were positive for AFB. The total percent prevalence was about 31% for sheep and 23% for goats respectively. There was no statistical difference in the presence of AFB in impression smears between sheep and goats (P>0.05).

Detection of MAP antibodies in serum samples by iELISA

Serological analysis was carried on serum samples from either sheep or goats for the presence of anti-MAP antibodies collected both at farms and abattoirs of district Peshawar. Overall, the percent seroprevalence of MAP in small ruminants using commercial iELISA was recorded and presented in Table II. Out of total 175 serum samples from sheep 16 samples were found positive for anti-MAP antibodies, whereas only 9 out 175 serum samples from goats were positive for antibodies against MAP. The total percent seroprevalence of MAP was recorded 9% in sheep and 5% in goats. There was no significant statistical difference in seroprevelance between sheep and goats (P>0.05).

 

Table V. PCR analyses revealed the presence of MAP in tissue samples of sheep and goats.

Species	Tissue samples collected at abattoir				P value
	Total samples	Positive samples	Negative samples	% Prevalence
Sheep	100	5	95	5.0
Goat	100	3	97	3.0
Total	200	08	192	4.0	0.268

 

PCR analyses revealed the presence of MAP in tissue samples from small ruminants

Molecular diagnosis of MAP in tissue samples (intestinal) was carried out by PCR targeting IS900 and IS1311 specific regions of MAP using 2 sets of primers presented in Table I. Only five samples from sheep and three samples from goats were found positive by PCR (Table V) using primer set 1 and primer set 2 and generated an amplicon of 626 bp (Supplementary Fig. 1) and 550 bp (Supplementary Fig. 2), respectively.

DISCUSSION

Paratuberculosis is a chronic granulomatous, debilitating bowl disease responsible for drastic decrease in production of dairy and meat animals. However, in the province of Khyber Pakhtunkhwa it has never been reported till date. Therefore, we aimed in this study to detect seroprevalence, identify MAP and its associated lesions in small ruminants of district Peshawar and produce baseline data for the future intervention regarding the control and mitigation of this disease. Paratuberculosis is not only dangerous for animals but it can pose serious threats to public health as well. As pTB is very chronic disease, therefore its diagnosis is rather cumbersome. The organism shed in the milk during clinical and sub clinical infection and have the potential to survive at pasteurization temperature (Grant et al., 2001). Debate on the role of the organism in the etiopathology of human Crohn’s disease is gaining importance as bacterium has been isolated from the breast milk of a patient with Crohn’s disease (Naser et al., 2000).

In the present study serum samples from small ruminants were analyzed by indirect ELISA. Antibodies against MAP were found in 9 % sheep and 5% goats in samples collected both at commercial farms and abattoir. The low prevalence percentage at farm level may be due to long survival rate of the disease and insensitive diagnostic tests. Moreover, because the MAP may go in latent stage (12 to 16 weeks) of infection and the levels of detectable antibodies through ELISA are significantly reduced, the ability to identify a truly positive paratuberculosis remains limited (Abbas et al., 2011). The current study shows similarity to the findings of (Hussain et al., 2018). He reported that the prevalence at an abattoir is higher than at the farm and the reason is quite understandable that mostly the low producer or untreatable animals are sold out by the farmers and those come to slaughter at the abattoirs. Sikandar et al. (2013) conducted a study to evaluate the effectiveness of conventional diagnostic tools including histopathological examination, ELISA and ZN staining for the prompt diagnosis of ovine paratuberculosis, the animals were randomly selected, from abattoirs of Jhang and 10.63% animals were declared as positive for MAP through ELISA.

Ziehl Nielsen (ZN) staining of fecal impression smears samples collected at commercial farms and abattoir exhibited AFB in 31% sheep and 23% goats. This study shows similarity with the findings reported elsewhere (Rehman et al., 2017). They reported that poor hygienic conditions at local farms increase the chances of occurrence of the disease. Along with this higher number of animals in a limited area, constant shedding of Mycobacterium by sick animals and ability of the bacteria to remain for longer time in the environment are the major predisposing elements of pTB. Emaciation and diarrhea were also mentioned in JD (Delgado et al., 2009). The shedding of MAP bacilli in fecal samples frequently precedes the onset of serum antibody responses (Stewart et al., 2006; Whittington et al., 2001). Hence, the current study revealed the very early onset of the antibodies response in the infected lambs, it would have been interesting to examine fecal shedding during the early post infection period, but restrictions on the availability of culturing facilities precluded these samples from being test. The preeminence of intestinal samples over mesenteric lymph nodes for the detection of MAP using ZN staining was indicated previously (Sikandar et al., 2013).

Postmortem examination revealed pathological lesions including thickness and corrugation in 30% and 22% of intestinal samples, while hemorrhages, edematous swelling was observed in 35% and 27% in MLN samples in sheep and goats respectively. Our results are in accordance with the finding reported elsewhere (Alharbi et al., 2012; Maxie et al., 2007). They observed that advanced cases of JD were typified by diffused intestinal thickening coupled with longitudinal and transverse corrugations that gave rise to asymmetrical folds having red surfaces but no ulcerations. A histopathological study in India revealed inflammation of intestine, thickening and corrugation of small intestine and granulomatous inflammation (Sivakumar et al., 2006). In the present study the mucosa and upper portions of the submucosa of the intestinal section, there was an increase infiltration of mononuclear cells along with mild infiltration of neutrophils and eosinophils. There was sloughing of the mucosal lining of the intestine. The mucosal gland of the intestine shows atrophy because of heavy infiltration of inflammatory cells. The epithelioid macrophage cytoplasm was darker and foamy in appearance. Another study also revealed that in cattle main lesions of JD usually confined to the intestine and associated lymph nodes (Tiwari et al., 2006). The thickening of the intestinal wall up to three or four times than normal with corrugation of the mucosa was characteristic for pTB. There was a thick capsule of fibrous connective tissue (FCT) in the mesenteric lymph nodes. In the cortical and parcortical regions variable sized calcified and variable sized necrotic areas by thin layer of FCT. It has also been revealed that thickening and corrugation of intestine along with enlargement of MLN were prominent in diseased animals (Koets et al., 2015).

The percent prevalence of MAP confirmed by PCR on abattoir level both for sheep and goats was 5% and 3% respectively. Although PCR is more sensitive technique than acid-fast staining, however the result obtained in this study showed a higher number of positive samples with acid-fast staining compared to PCR (Khan et al., 2010). This significant difference between PCR and ZN staining might be due to low specificity of ZN staining. Paratuberculosis might be hindering factors present in the fecal samples or their might be a chance of missing of MAP DNA in 4-6 µl of the sample collected from tissue samples for PCR, while ZN staining revealed the presence of AFB in larger sample spread over the slide or there could be some more unknown factors involved (Hussain et al., 2018).

Various conventional and molecular techniques were used in this study for the detection of Mycobacterium avium subsp. paratuberculosis (MAP) in samples taken from sheep and goats. Sensitivity and specificity of conventional methods (ZN staining and Postmortem) were found lower compared to PCR and iELISA. Since ZN staining could detect acid fast bacilli (AFB) and postmortem only examined gross and histopathological lesions could be possible. It is well known that all AFB are not MAP, therefore most of the samples found positive by ZN staining were negative by PCR and iELISA. In this study, less number of samples were found positive by iELISA and PCR. No doubt these techniques are more sensitive and specific for the detection of pathogens, however the reason of lower sensitivity of these tools might be less number of samples analyzed in this study at limited geographical locations. Therefore, we recommend extensive epidemiological investigation throughout the province to devise a comprehensive therapeutics and control strategies for MAP infection in small ruminants.

Moreover, the low prevalence of MAP by PCR compared to ELISA might be due long incubation period of MAP and extensive use of antibiotics in small ruminants in the region of study. These results were found in similarity index with the findings reported elsewhere (Hajikolaei et al., 2006). Another study reported that primers targeted insertion sequence against IS900 and IS1311 can magnify DNA regions of MAP (Sevilla et al., 2005).

In this study analyses of serum samples by iELISA revealed the presence of antibodies against MAP in 9% sheep and 5% goats. Additionally, PCR revealed the presence of MAP in 5% sheep and 3% goat’s tissue samples. Compared to studies conducted elsewhere in Pakistan revealed 11% sero-prevalence of MAP in small ruminants by iELISA (Sikandar et al., 2013). Moreover, molecular techniques confirmed the presence of MAP in 12.8% and 14.2% samples from ruminants (Khan et al., 2010). Sero-molecular prevalence of MAP in small ruminants at Peshawar district during specific time period of the study was found lower compared to other parts of the country (Sikandar et al., 2013; Khan et al., 2010).

An iELISA is an appropriate method for the detection of chronic granulomatous infections like pTB as these types of diseases are mostly taking long time to exhibit clinical signs due to very slow growth of causative agent. In this investigation, presence of MAP in small ruminants at district Peshawar is indicated by the resultant 9% and 5% seroprevalence both in sheep and goats using a specific commercially available iELISA Kit. The present study concluded that the presence of anti-MAP antibodies in small ruminants, its associated lesions and AFB in tissue samples, and later on confirmation by PCR implicated that MAP could be a serious threat to livestock industry, as well as to public health at district Peshawar.

ACKNOWLEDGEMENT

The research work was financially supported by Start-up research grant program (SRGP), Higher Education Commission (HEC) Islamabad, Pakistan (SRGP-1327) and Pak-US Science and Technology Cooperation Program, Phase 7, 2017. Pak-US S and T cooperation program is supported and implemented by the National Academy of Sciences (NAS), USA and Higher Education Commission (HEC), Pakistan. We are also thankful to Department of Animal Health, The University of Agriculture, Peshawar for supporting this research work.

Supplementary material

There is supplementary material associated with this article. Access the material online at: https://dx.doi.org/10.17582/journal.pjz/20191014071021

Statement of conflict of interest

The authors have no conflict of interest to disclose.

REFERENCES

Abbas, M.M., Munir, S.A., Khaliq, M.I., Haq, M.T. and Qureshi, Z.A., 2011. Detection of paratuberculosis in breeding bulls at Pakistani semen production units. A continuous source of threat. J. ISRN Vet. Sci., 501235: 1-8. https://doi.org/10.5402/2011/501235

Alharbi, K.B., Swailem, M.A., Dubaib, A., AlYamani, E., Naeem, A., Shehata, M., Hashad, M.E., Albusadah, K.A. and Mahmoud, O.M., 2012. Pathology and molecular diagnosis of paratuberculosis of camels. Trop. Anim. Hlth. Prod., 44: 173-177. https://doi.org/10.1007/s11250-011-9905-2

Ayele, W.Y., Machackova, M. and Pavlik, I., 2001. The transmission and impact of paratuberculosis infection in domestic and wild ruminants. Vet. Med. Czech., 46: 205–224. https://doi.org/10.17221/7878-VETMED

Bancroft, J.D. and Gamble, M., 2007. Theory and practice of histological techniques. 5th ed. Churchill Livingstone, London, pp. 125-138.

Beard, P.M., Daniels, M.J., Henderson, D., Pirie, A., Rudge, K., Buxton, D., Rhind, S., Greig, A.R., Hutchings, M., McKendrick, I., Stevenson, K. and Sharp, J.M., 2001. Paratuberculosis infection of non-ruminant wildlife in Scotland. J. clin. Microbiol., 39: 1517–1521. https://doi.org/10.1128/JCM.39.4.1517-1521.2001

Buergelt, C.D., Layton, A.W., Ginn, P.E., Taylor, M., King, J.M., Habecker, P.L., Mauldin, E., Whitlock, R., Rossiter, C. and Collins, M.T., 2000. The pathology of spontaneous paratuberculosis in the North American Bison (Bison bison). Vet. Pathol., 37: 428–438. https://doi.org/10.1354/vp.37-5-428

Cappuccino, J.G. and Sherman, N., 2008. Microbiology, a laboratory manual. 7th Ed. Dorling Kindersley, India. pp. 77-79.

Delgado, F., Etchechoury, D., Gioffré, A., Paolicchi, F., Blanco, V.F., Mundo, S. and Romano, M.I., 2009. Comparison between two in situ methods for Mycobacteriumavium subspecies paratuberculosis detection in tissue samples. Trop. Anim. Hlth. Prod., 42: 633–638.

Eltholth, M.M., Marsh, V.R., Winden, S.V. and Guitian, F.J., 2009. Contamination of food products with Mycobacterium avium subsp. paratuberculosis: A systematic review. J. appl. Microbiol., 107: 1061–1071. https://doi.org/10.1111/j.1365-2672.2009.04286.x

Fiorentino, M.A., Gioffré, A., Cirone, K.C., Morsella, Alonso, B., Delgado, F. and Paolicchi, F., 2012. First isolation of Mycobacterium aviumsubsp. paratuberculosis in a dairy goat in Argentina: Pathology and molecular characterization. Small Rum Res., 108: 133– 136. https://doi.org/10.1016/j.smallrumres.2012.06.010

Grant, R.I., Rowe, M.T., Dundee, L. and Hitchings, E., 2001. Mycobacterium avium subsp. paratuberculosis its incidence, heat resistance and detection in milk and dairy products. Int. J. Dairy Technol., 54: 2–13. https://doi.org/10.1046/j.1471-0307.2001.00009.x

Greig, A., Stevenson, K., Henderson, D., Perez, V., Hughes, V., Pavlik, I., Hines, ME., McKendrick, I. and Sharp, J.M., 1999. Epidemiological study of paratuberculosis in wild rabbits in Scotland. J. clin. Microbiol., 37: 1746–1751. https://doi.org/10.1128/JCM.37.6.1746-1751.1999

Gwozdz, J.M., 2010. Paratuberculosis (Johne’s Disease). Australian and New Zealand Standard Diagnostic Procedures., 2010.

Hajikolaei, M.R., Ghorbanpoor, M. and Slaymani, M., 2006. The prevalence of Mycobacterium paratuberculosis infection in ileocecal valve of cattle slaughtered in Ahvaz abattoir. Iran. J. Vet. Res., 7: 77-80.

Hasonova, L., Trcka, I., Babak, V. and Rozsypalova, Z., 2009. Distribution of Mycobacterium avium subsp. paratuberculosisin tissues of naturally infected cattle as affected by age. Vet. Med., 54: 257–269. https://doi.org/10.17221/54/2009-VETMED

Hines, M.E., Stabel, J.R., Sweeney, R.W., Griffin, F., Talaat, A.M., Bakker, D. and Benedictus, G., 2007. Experimental challenge models for Johne’s disease. A review and proposed international guidelines. Vet. Microbiol., 122: 197–222. https://doi.org/10.1016/j.vetmic.2007.03.009

Hussain, S.M., Muhammad, T.J., Aziz, R., Farzana, R. and Mehwish, Q., 2018. Prevalence of paratuberculosis in cattle and buffaloes in Punjab Pakistan. Pakistan J. agricul. Sci., 55: 427-432.

Khan, F.A., Chaudhry, Z.I., Ali, M.I., Khan, S., Mumtaz, N. and Ahmad, I., 2010. Detection of Mycobacterium avium subsp. paratuberculosis in tissue samples of cattle and buffaloes. Trop. Anim. Hlth. Prod., 42: 633–638. https://doi.org/10.1007/s11250-009-9467-8

Koets, A.P., Eda, S. and Sreevatsan, S., 2015. The within host dynamics of Mycobacterium avium subsp. paratuberculosis infection in cattle. Vet. Res., 46: 1-17. https://doi.org/10.1186/s13567-015-0185-0

Kruze, J., Monti, G., Schulze, F., Mella, A. and Leiva, S., 2013. Herd–level prevalence of Map infection in dairy herds of southern Chile determined by culture of environmental fecal samples and bulk–tank milk qPCR. Prev. Vet. Med. 111: 319–324. https://doi.org/10.1016/j.prevetmed.2013.05.011

Liapi, M., Leontides, L., Kostoulas, P., Botsaris, G., Iacovou, Y., Rees, C., Georgiou, K., Smith, G., Naseby, D.C., 2011. Bayesian estimation of the true prevalence of Mycobacterium aviumsubsp. paratuberculosis infection in Cypriot dairy sheep and goat flocks. Small Rumin. Res., 95: 174–178. https://doi.org/10.1016/j.smallrumres.2010.09.010

Lombard, J.E., Gardner, I.A., Jafarzadeh, S., Fossler, C., Harris, B. and Capsel, R., 2013. Herd–level prevalence of Mycobacterium aviumsubsp. paratuberculosis infection in United States dairy herds in 2007. Prev. Vet. Med., 108: 234–238. https://doi.org/10.1016/j.prevetmed.2012.08.006

Manning, J.B.E., Steinberg, H.V., Krebs and Collins, M.T., 2002. Diagnostic testing patterns of natural Mycobacterium paratuberculosis infection in pygmy goats. Can. J. Vet. Res. 67: 213–218.

Maxie, M.G., Jubb K.V.F., Kennedy, P.C. and Palmer, N.C., 2007. Pathology of domestic animals. Saunders Elsevier, London, 5: 222-225.

Mercier, P., Baudry, C., Beaudeau, F., Seegers, H. and Malher, X., 2010. Estimated prevalence of Mycobacterium avium subspecies paratuberculosis infection in herds of dairy goats in France. Vet. Rec., 167: 412–416. https://doi.org/10.1136/vr.c4454

Naser, A.S., Shafran, I. and Schwartz, D., 2000. Isolation of Mycobacterium avium subspecies paratuberculosis from breast milk of Crohn’s disease patients. Am. J. Gastroenterol., 95: 1094–1095. https://doi.org/10.1111/j.1572-0241.2000.01954.x

Nielsen, S.S., 2008. Transitions in diagnostic tests used for detection of Mycobacterium avium subsp. paratuberculosis infections in cattle. Vet. Microbiol., 132: 274–282. https://doi.org/10.1016/j.vetmic.2008.05.018

Okuni, J.B., 2013. Occurence of paratuberculosis in African countries: A review. J. Vet. Adv., 3: 1–8.

Rehman, A., Javed, M.T., Rizvi, F. and Khan, M.N., 2017. Prevalence and pathology of paratuberculosis in cattle and buffaloes at Faisalabad abattoir. Pakistan J. agric. Sci., 54: 189-194. https://doi.org/10.21162/PAKJAS/17.5989

Salgado, M., Kruze, J. and Collinsm M.T., 2007. Diagnosis of paratuberculosis by fecal culture and ELISA on milk and serum samples in two types of Chilean dairy goat herds. J. Vet. Diagn. Invest. 19: 99–102. https://doi.org/10.1177/104063870701900117

Sevilla, I., Singh, S.V., Garrido, J.M., Aduriz, G., Rodríguez, S., Geijo, M.V., Whittington, R., Saunders, J.V., Whitlock, R.H. and Juste, R.A., 2005. Molecular typing of Mycobacterium avium subsp. paratuberculosis strains from different hosts and regions. Rev. Scienti. Tech. Int. Office Epizoot., 24: 1061–1066. https://doi.org/10.20506/rst.24.3.1634

Seyyedin, M., Zahraei, T. and Najafi, M.F., 2010. Comparison of isolation frequency of Mycobacterium avium subsp. paratuberculosisfrom different types of samples. Pak. Vet. J., 30: 143–149.

Sikandar, A., Cheema, A.H., Adil, M., Younus, M., Zaneb, H., Zaman, M.A., Tipu, M.Y. and Masood, S., 2013. Ovine paratuberculosis-a histopathological study from Pakistan. J. Anim. Pl. Sci., 23: 749-753.

Singh, S. V., Chaubey, K. K., Gupta. S., Gupta, V.K., Agrawal, N.D. and Kumar, N., 2013. Co–infection of Mycobacterium avium subspecies paratuberculosis and Brucellamelitensis in a sirohi breed of goats in India. Adv. Anim. Vet. Sci., 1: 188 – 190.

Sivakumar, P., Tripathi, B.N., Singh, N. and Sharma, A.K., 2006. Pathology of naturally occurring Paratuberculosis in water buffaloes (Bubalus bubalis). Vet. Pathol., 43: 455-462. https://doi.org/10.1354/vp.43-4-455

Stewart, D.J., Vaughan, J.A., Stiles, P.L., Noske, P.J., Tizard, M.L.V., Prowse, S.J., Michalski, W.P., Butler, K.L. and Jones, S.L., 2006. A long-term study in Angora goats experimentally infected with Mycobacterium avium subsp. paratuberculosis: clinical disease, fecal culture and immunological studies. Vet. Microbiol., 113: 13–24. https://doi.org/10.1016/j.vetmic.2005.09.015

Thorel, M.F., Krichevsky, M. and Levy-Frebault, V.V., 1990. Numerical taxonomy of mycobactin-dependent mycobacteria, emended description of Mycobacterium aviumsubsp. avium subsp. nov., Mycobacterium avium subsp. paratuberculosis subsp. nov and Mycobacterium avium subsp. silvaticum subsp. nov. Int. J. System. Bact., 40: 254–260. https://doi.org/10.1099/00207713-40-3-254

Tiwari, A., Van-Leeuwen, J.A., McKenna, S.L., Keefe, G.P. and Barkema, H.W., 2006. Johne’s disease in Canada part I: Clinical symptoms, pathophysiology, diagnosis and prevalence in dairy herds. Canadian Vet. J., 47: 874-882.

Twort, F.W., 1910. A method for isolating and growing the lepra bacillus of man. (Preliminary note.). Royal Society of London, pp. 156-158.

Vansnick, E., 2004. Johne’s disease in zoo animals: Development of molecular tools for the detection and characterization of Mycobacterium avium subspecies paratuberculosis. Doctorial thesis, Instituutvoor Tropische Geneeskunde Departement Diergeneeskunde, Belgium.

Whittington, R.J., Taragel, C.A., Ottaway, S., Marsh, I., Seaman, J. and Fridriksdottir, V., 2001. Molecular epidemiological confirmation and circumstances of occurrence of sheep (S) strains of Mycobacterium avium subsp. paratuberculosis in cases of paratuberculosis in cattle in Australia and sheep and cattle in Iceland. Vet. Microbiol., 79: 311–322. https://doi.org/10.1016/S0378-1135(00)00364-3